ID: 916361990

View in Genome Browser
Species Human (GRCh38)
Location 1:163980642-163980664
Sequence ATGTTTCATCAGCAGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916361986_916361990 7 Left 916361986 1:163980612-163980634 CCTTTCTTTCCTGGAAAAACCAC No data
Right 916361990 1:163980642-163980664 ATGTTTCATCAGCAGCAAGATGG No data
916361988_916361990 -2 Left 916361988 1:163980621-163980643 CCTGGAAAAACCACAGGAGTGAT No data
Right 916361990 1:163980642-163980664 ATGTTTCATCAGCAGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916361990 Original CRISPR ATGTTTCATCAGCAGCAAGA TGG Intergenic
No off target data available for this crispr