ID: 916361991

View in Genome Browser
Species Human (GRCh38)
Location 1:163980653-163980675
Sequence GCAGCAAGATGGATAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916361986_916361991 18 Left 916361986 1:163980612-163980634 CCTTTCTTTCCTGGAAAAACCAC No data
Right 916361991 1:163980653-163980675 GCAGCAAGATGGATAATAAAAGG No data
916361989_916361991 -1 Left 916361989 1:163980631-163980653 CCACAGGAGTGATGTTTCATCAG No data
Right 916361991 1:163980653-163980675 GCAGCAAGATGGATAATAAAAGG No data
916361988_916361991 9 Left 916361988 1:163980621-163980643 CCTGGAAAAACCACAGGAGTGAT No data
Right 916361991 1:163980653-163980675 GCAGCAAGATGGATAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916361991 Original CRISPR GCAGCAAGATGGATAATAAA AGG Intergenic
No off target data available for this crispr