ID: 916361992

View in Genome Browser
Species Human (GRCh38)
Location 1:163980654-163980676
Sequence CAGCAAGATGGATAATAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916361989_916361992 0 Left 916361989 1:163980631-163980653 CCACAGGAGTGATGTTTCATCAG No data
Right 916361992 1:163980654-163980676 CAGCAAGATGGATAATAAAAGGG No data
916361986_916361992 19 Left 916361986 1:163980612-163980634 CCTTTCTTTCCTGGAAAAACCAC No data
Right 916361992 1:163980654-163980676 CAGCAAGATGGATAATAAAAGGG No data
916361988_916361992 10 Left 916361988 1:163980621-163980643 CCTGGAAAAACCACAGGAGTGAT No data
Right 916361992 1:163980654-163980676 CAGCAAGATGGATAATAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916361992 Original CRISPR CAGCAAGATGGATAATAAAA GGG Intergenic
No off target data available for this crispr