ID: 916364863

View in Genome Browser
Species Human (GRCh38)
Location 1:164014617-164014639
Sequence TCTTCATGATCACAACACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916364860_916364863 -1 Left 916364860 1:164014595-164014617 CCTCAAGGCCTCTCCATGTGTCT No data
Right 916364863 1:164014617-164014639 TCTTCATGATCACAACACAGTGG No data
916364859_916364863 7 Left 916364859 1:164014587-164014609 CCATGTAGCCTCAAGGCCTCTCC No data
Right 916364863 1:164014617-164014639 TCTTCATGATCACAACACAGTGG No data
916364858_916364863 8 Left 916364858 1:164014586-164014608 CCCATGTAGCCTCAAGGCCTCTC No data
Right 916364863 1:164014617-164014639 TCTTCATGATCACAACACAGTGG No data
916364861_916364863 -9 Left 916364861 1:164014603-164014625 CCTCTCCATGTGTCTCTTCATGA No data
Right 916364863 1:164014617-164014639 TCTTCATGATCACAACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916364863 Original CRISPR TCTTCATGATCACAACACAG TGG Intergenic