ID: 916365965

View in Genome Browser
Species Human (GRCh38)
Location 1:164028051-164028073
Sequence AACAGCTCTTGGTCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916365965_916365970 10 Left 916365965 1:164028051-164028073 CCAGTAGCAGACCAAGAGCTGTT No data
Right 916365970 1:164028084-164028106 AGAGCAGTTATCTGTGGAGGAGG No data
916365965_916365968 4 Left 916365965 1:164028051-164028073 CCAGTAGCAGACCAAGAGCTGTT No data
Right 916365968 1:164028078-164028100 AAAAGGAGAGCAGTTATCTGTGG No data
916365965_916365971 11 Left 916365965 1:164028051-164028073 CCAGTAGCAGACCAAGAGCTGTT No data
Right 916365971 1:164028085-164028107 GAGCAGTTATCTGTGGAGGAGGG No data
916365965_916365969 7 Left 916365965 1:164028051-164028073 CCAGTAGCAGACCAAGAGCTGTT No data
Right 916365969 1:164028081-164028103 AGGAGAGCAGTTATCTGTGGAGG No data
916365965_916365973 16 Left 916365965 1:164028051-164028073 CCAGTAGCAGACCAAGAGCTGTT No data
Right 916365973 1:164028090-164028112 GTTATCTGTGGAGGAGGGCAGGG No data
916365965_916365972 15 Left 916365965 1:164028051-164028073 CCAGTAGCAGACCAAGAGCTGTT No data
Right 916365972 1:164028089-164028111 AGTTATCTGTGGAGGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916365965 Original CRISPR AACAGCTCTTGGTCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr