ID: 916365972

View in Genome Browser
Species Human (GRCh38)
Location 1:164028089-164028111
Sequence AGTTATCTGTGGAGGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916365967_916365972 4 Left 916365967 1:164028062-164028084 CCAAGAGCTGTTTCTCAAAAGGA No data
Right 916365972 1:164028089-164028111 AGTTATCTGTGGAGGAGGGCAGG No data
916365965_916365972 15 Left 916365965 1:164028051-164028073 CCAGTAGCAGACCAAGAGCTGTT No data
Right 916365972 1:164028089-164028111 AGTTATCTGTGGAGGAGGGCAGG No data
916365964_916365972 16 Left 916365964 1:164028050-164028072 CCCAGTAGCAGACCAAGAGCTGT No data
Right 916365972 1:164028089-164028111 AGTTATCTGTGGAGGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916365972 Original CRISPR AGTTATCTGTGGAGGAGGGC AGG Intergenic
No off target data available for this crispr