ID: 916369829

View in Genome Browser
Species Human (GRCh38)
Location 1:164079832-164079854
Sequence AATAGCTTTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916369827_916369829 14 Left 916369827 1:164079795-164079817 CCATGTCATGTGTGAATAGCTAC No data
Right 916369829 1:164079832-164079854 AATAGCTTTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916369829 Original CRISPR AATAGCTTTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr