ID: 916370072

View in Genome Browser
Species Human (GRCh38)
Location 1:164082047-164082069
Sequence GCTGAGGCAAAGAACCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916370072_916370075 25 Left 916370072 1:164082047-164082069 CCTCTGAGGTTCTTTGCCTCAGC No data
Right 916370075 1:164082095-164082117 TGCAACTGCATTGCAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916370072 Original CRISPR GCTGAGGCAAAGAACCTCAG AGG (reversed) Intergenic
No off target data available for this crispr