ID: 916374607

View in Genome Browser
Species Human (GRCh38)
Location 1:164138756-164138778
Sequence ATCAATTAGCTATATATGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916374607_916374610 10 Left 916374607 1:164138756-164138778 CCACGCATATATAGCTAATTGAT No data
Right 916374610 1:164138789-164138811 GTTGCCAAGAATATGCAATGGGG No data
916374607_916374608 8 Left 916374607 1:164138756-164138778 CCACGCATATATAGCTAATTGAT No data
Right 916374608 1:164138787-164138809 CAGTTGCCAAGAATATGCAATGG No data
916374607_916374609 9 Left 916374607 1:164138756-164138778 CCACGCATATATAGCTAATTGAT No data
Right 916374609 1:164138788-164138810 AGTTGCCAAGAATATGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916374607 Original CRISPR ATCAATTAGCTATATATGCG TGG (reversed) Intergenic
No off target data available for this crispr