ID: 916378635

View in Genome Browser
Species Human (GRCh38)
Location 1:164183938-164183960
Sequence ACATATCCACTGTTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916378635_916378641 17 Left 916378635 1:164183938-164183960 CCATTCTCCAACAGTGGATATGT No data
Right 916378641 1:164183978-164184000 CCCATTACAGACAATGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916378635 Original CRISPR ACATATCCACTGTTGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr