ID: 916379300

View in Genome Browser
Species Human (GRCh38)
Location 1:164190850-164190872
Sequence GTATATTCCATGGCAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916379297_916379300 17 Left 916379297 1:164190810-164190832 CCATTTTGATCATGATTTTATAT No data
Right 916379300 1:164190850-164190872 GTATATTCCATGGCAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916379300 Original CRISPR GTATATTCCATGGCAAAAAT GGG Intergenic
No off target data available for this crispr