ID: 916380565

View in Genome Browser
Species Human (GRCh38)
Location 1:164206326-164206348
Sequence TGGATGTGGCCCACCCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916380565_916380571 7 Left 916380565 1:164206326-164206348 CCAATGTGGGTGGGCCACATCCA No data
Right 916380571 1:164206356-164206378 GGAGATCTTAGTAGAACAAAAGG No data
916380565_916380574 12 Left 916380565 1:164206326-164206348 CCAATGTGGGTGGGCCACATCCA No data
Right 916380574 1:164206361-164206383 TCTTAGTAGAACAAAAGGTGGGG No data
916380565_916380572 10 Left 916380565 1:164206326-164206348 CCAATGTGGGTGGGCCACATCCA No data
Right 916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG No data
916380565_916380575 18 Left 916380565 1:164206326-164206348 CCAATGTGGGTGGGCCACATCCA No data
Right 916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG No data
916380565_916380573 11 Left 916380565 1:164206326-164206348 CCAATGTGGGTGGGCCACATCCA No data
Right 916380573 1:164206360-164206382 ATCTTAGTAGAACAAAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916380565 Original CRISPR TGGATGTGGCCCACCCACAT TGG (reversed) Intergenic
No off target data available for this crispr