ID: 916380572

View in Genome Browser
Species Human (GRCh38)
Location 1:164206359-164206381
Sequence GATCTTAGTAGAACAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916380563_916380572 12 Left 916380563 1:164206324-164206346 CCCCAATGTGGGTGGGCCACATC No data
Right 916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG No data
916380568_916380572 -10 Left 916380568 1:164206346-164206368 CCAATCCCTTGGAGATCTTAGTA No data
Right 916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG No data
916380565_916380572 10 Left 916380565 1:164206326-164206348 CCAATGTGGGTGGGCCACATCCA No data
Right 916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG No data
916380567_916380572 -4 Left 916380567 1:164206340-164206362 CCACATCCAATCCCTTGGAGATC No data
Right 916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG No data
916380564_916380572 11 Left 916380564 1:164206325-164206347 CCCAATGTGGGTGGGCCACATCC No data
Right 916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916380572 Original CRISPR GATCTTAGTAGAACAAAAGG TGG Intergenic
No off target data available for this crispr