ID: 916380575

View in Genome Browser
Species Human (GRCh38)
Location 1:164206367-164206389
Sequence TAGAACAAAAGGTGGGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916380570_916380575 -8 Left 916380570 1:164206352-164206374 CCTTGGAGATCTTAGTAGAACAA No data
Right 916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG No data
916380568_916380575 -2 Left 916380568 1:164206346-164206368 CCAATCCCTTGGAGATCTTAGTA No data
Right 916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG No data
916380569_916380575 -7 Left 916380569 1:164206351-164206373 CCCTTGGAGATCTTAGTAGAACA No data
Right 916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG No data
916380565_916380575 18 Left 916380565 1:164206326-164206348 CCAATGTGGGTGGGCCACATCCA No data
Right 916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG No data
916380567_916380575 4 Left 916380567 1:164206340-164206362 CCACATCCAATCCCTTGGAGATC No data
Right 916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG No data
916380564_916380575 19 Left 916380564 1:164206325-164206347 CCCAATGTGGGTGGGCCACATCC No data
Right 916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG No data
916380563_916380575 20 Left 916380563 1:164206324-164206346 CCCCAATGTGGGTGGGCCACATC No data
Right 916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916380575 Original CRISPR TAGAACAAAAGGTGGGGTAA AGG Intergenic
No off target data available for this crispr