ID: 916391420

View in Genome Browser
Species Human (GRCh38)
Location 1:164334799-164334821
Sequence TCTCTCATACAGAAGGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916391418_916391420 17 Left 916391418 1:164334759-164334781 CCTTACGCATGCACATATTTTGA No data
Right 916391420 1:164334799-164334821 TCTCTCATACAGAAGGTACTTGG No data
916391417_916391420 27 Left 916391417 1:164334749-164334771 CCATTTATGACCTTACGCATGCA No data
Right 916391420 1:164334799-164334821 TCTCTCATACAGAAGGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916391420 Original CRISPR TCTCTCATACAGAAGGTACT TGG Intergenic
No off target data available for this crispr