ID: 916391420 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:164334799-164334821 |
Sequence | TCTCTCATACAGAAGGTACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
916391418_916391420 | 17 | Left | 916391418 | 1:164334759-164334781 | CCTTACGCATGCACATATTTTGA | No data | ||
Right | 916391420 | 1:164334799-164334821 | TCTCTCATACAGAAGGTACTTGG | No data | ||||
916391417_916391420 | 27 | Left | 916391417 | 1:164334749-164334771 | CCATTTATGACCTTACGCATGCA | No data | ||
Right | 916391420 | 1:164334799-164334821 | TCTCTCATACAGAAGGTACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
916391420 | Original CRISPR | TCTCTCATACAGAAGGTACT TGG | Intergenic | ||
No off target data available for this crispr |