ID: 916394063

View in Genome Browser
Species Human (GRCh38)
Location 1:164366053-164366075
Sequence TGACCTGAGTATGCACTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916394063_916394064 -8 Left 916394063 1:164366053-164366075 CCACAAAGTGCATACTCAGGTCA No data
Right 916394064 1:164366068-164366090 TCAGGTCAACCACATACTAGAGG No data
916394063_916394071 30 Left 916394063 1:164366053-164366075 CCACAAAGTGCATACTCAGGTCA No data
Right 916394071 1:164366106-164366128 GACCCCTACAAGCCTGACAAAGG No data
916394063_916394065 -7 Left 916394063 1:164366053-164366075 CCACAAAGTGCATACTCAGGTCA No data
Right 916394065 1:164366069-164366091 CAGGTCAACCACATACTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916394063 Original CRISPR TGACCTGAGTATGCACTTTG TGG (reversed) Intergenic
No off target data available for this crispr