ID: 916394064

View in Genome Browser
Species Human (GRCh38)
Location 1:164366068-164366090
Sequence TCAGGTCAACCACATACTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916394061_916394064 -5 Left 916394061 1:164366050-164366072 CCACCACAAAGTGCATACTCAGG No data
Right 916394064 1:164366068-164366090 TCAGGTCAACCACATACTAGAGG No data
916394063_916394064 -8 Left 916394063 1:164366053-164366075 CCACAAAGTGCATACTCAGGTCA No data
Right 916394064 1:164366068-164366090 TCAGGTCAACCACATACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916394064 Original CRISPR TCAGGTCAACCACATACTAG AGG Intergenic
No off target data available for this crispr