ID: 916394065

View in Genome Browser
Species Human (GRCh38)
Location 1:164366069-164366091
Sequence CAGGTCAACCACATACTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916394061_916394065 -4 Left 916394061 1:164366050-164366072 CCACCACAAAGTGCATACTCAGG No data
Right 916394065 1:164366069-164366091 CAGGTCAACCACATACTAGAGGG No data
916394063_916394065 -7 Left 916394063 1:164366053-164366075 CCACAAAGTGCATACTCAGGTCA No data
Right 916394065 1:164366069-164366091 CAGGTCAACCACATACTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916394065 Original CRISPR CAGGTCAACCACATACTAGA GGG Intergenic
No off target data available for this crispr