ID: 916399021

View in Genome Browser
Species Human (GRCh38)
Location 1:164425588-164425610
Sequence GGGTTACTGACTTATAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916399021_916399027 15 Left 916399021 1:164425588-164425610 CCAGGATTATAAGTCAGTAACCC No data
Right 916399027 1:164425626-164425648 AGTTTTATGAAGAAACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916399021 Original CRISPR GGGTTACTGACTTATAATCC TGG (reversed) Intergenic
No off target data available for this crispr