ID: 916402948

View in Genome Browser
Species Human (GRCh38)
Location 1:164468698-164468720
Sequence TATGGTAGCCAGGTCATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916402948_916402951 -2 Left 916402948 1:164468698-164468720 CCATTTATGACCTGGCTACCATA No data
Right 916402951 1:164468719-164468741 TAAGCCTACACTCTAATAGAAGG No data
916402948_916402954 16 Left 916402948 1:164468698-164468720 CCATTTATGACCTGGCTACCATA No data
Right 916402954 1:164468737-164468759 GAAGGTCATGATTATACTTTGGG No data
916402948_916402953 15 Left 916402948 1:164468698-164468720 CCATTTATGACCTGGCTACCATA No data
Right 916402953 1:164468736-164468758 AGAAGGTCATGATTATACTTTGG No data
916402948_916402955 23 Left 916402948 1:164468698-164468720 CCATTTATGACCTGGCTACCATA No data
Right 916402955 1:164468744-164468766 ATGATTATACTTTGGGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916402948 Original CRISPR TATGGTAGCCAGGTCATAAA TGG (reversed) Intergenic
No off target data available for this crispr