ID: 916402950

View in Genome Browser
Species Human (GRCh38)
Location 1:164468716-164468738
Sequence TCTATTAGAGTGTAGGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916402950_916402954 -2 Left 916402950 1:164468716-164468738 CCATAAGCCTACACTCTAATAGA No data
Right 916402954 1:164468737-164468759 GAAGGTCATGATTATACTTTGGG No data
916402950_916402955 5 Left 916402950 1:164468716-164468738 CCATAAGCCTACACTCTAATAGA No data
Right 916402955 1:164468744-164468766 ATGATTATACTTTGGGTTCCTGG No data
916402950_916402953 -3 Left 916402950 1:164468716-164468738 CCATAAGCCTACACTCTAATAGA No data
Right 916402953 1:164468736-164468758 AGAAGGTCATGATTATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916402950 Original CRISPR TCTATTAGAGTGTAGGCTTA TGG (reversed) Intergenic
No off target data available for this crispr