ID: 916402951

View in Genome Browser
Species Human (GRCh38)
Location 1:164468719-164468741
Sequence TAAGCCTACACTCTAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916402945_916402951 28 Left 916402945 1:164468668-164468690 CCTGCTGTAAGAAGGACTTTTTT No data
Right 916402951 1:164468719-164468741 TAAGCCTACACTCTAATAGAAGG No data
916402948_916402951 -2 Left 916402948 1:164468698-164468720 CCATTTATGACCTGGCTACCATA No data
Right 916402951 1:164468719-164468741 TAAGCCTACACTCTAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916402951 Original CRISPR TAAGCCTACACTCTAATAGA AGG Intergenic
No off target data available for this crispr