ID: 916402952

View in Genome Browser
Species Human (GRCh38)
Location 1:164468723-164468745
Sequence ATGACCTTCTATTAGAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916402952_916402953 -10 Left 916402952 1:164468723-164468745 CCTACACTCTAATAGAAGGTCAT No data
Right 916402953 1:164468736-164468758 AGAAGGTCATGATTATACTTTGG No data
916402952_916402955 -2 Left 916402952 1:164468723-164468745 CCTACACTCTAATAGAAGGTCAT No data
Right 916402955 1:164468744-164468766 ATGATTATACTTTGGGTTCCTGG No data
916402952_916402954 -9 Left 916402952 1:164468723-164468745 CCTACACTCTAATAGAAGGTCAT No data
Right 916402954 1:164468737-164468759 GAAGGTCATGATTATACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916402952 Original CRISPR ATGACCTTCTATTAGAGTGT AGG (reversed) Intergenic
No off target data available for this crispr