ID: 916402955

View in Genome Browser
Species Human (GRCh38)
Location 1:164468744-164468766
Sequence ATGATTATACTTTGGGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916402948_916402955 23 Left 916402948 1:164468698-164468720 CCATTTATGACCTGGCTACCATA No data
Right 916402955 1:164468744-164468766 ATGATTATACTTTGGGTTCCTGG No data
916402950_916402955 5 Left 916402950 1:164468716-164468738 CCATAAGCCTACACTCTAATAGA No data
Right 916402955 1:164468744-164468766 ATGATTATACTTTGGGTTCCTGG No data
916402952_916402955 -2 Left 916402952 1:164468723-164468745 CCTACACTCTAATAGAAGGTCAT No data
Right 916402955 1:164468744-164468766 ATGATTATACTTTGGGTTCCTGG No data
916402949_916402955 13 Left 916402949 1:164468708-164468730 CCTGGCTACCATAAGCCTACACT No data
Right 916402955 1:164468744-164468766 ATGATTATACTTTGGGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916402955 Original CRISPR ATGATTATACTTTGGGTTCC TGG Intergenic
No off target data available for this crispr