ID: 916404009

View in Genome Browser
Species Human (GRCh38)
Location 1:164479169-164479191
Sequence TTGTATATAAATAAGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916404006_916404009 28 Left 916404006 1:164479118-164479140 CCGGGCTTTACTCAGACAAATCA No data
Right 916404009 1:164479169-164479191 TTGTATATAAATAAGGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916404009 Original CRISPR TTGTATATAAATAAGGTAAA TGG Intergenic
No off target data available for this crispr