ID: 916404815

View in Genome Browser
Species Human (GRCh38)
Location 1:164487704-164487726
Sequence ACTCCAGGTTCTCTGACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916404815_916404820 24 Left 916404815 1:164487704-164487726 CCAAAAGTCAGAGAACCTGGAGT No data
Right 916404820 1:164487751-164487773 AAGGTTGTCCCAGCACCAAGAGG No data
916404815_916404818 5 Left 916404815 1:164487704-164487726 CCAAAAGTCAGAGAACCTGGAGT No data
Right 916404818 1:164487732-164487754 TATCCAAGTACAGGAGAAGAAGG No data
916404815_916404821 25 Left 916404815 1:164487704-164487726 CCAAAAGTCAGAGAACCTGGAGT No data
Right 916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG No data
916404815_916404817 -4 Left 916404815 1:164487704-164487726 CCAAAAGTCAGAGAACCTGGAGT No data
Right 916404817 1:164487723-164487745 GAGTTCTGATATCCAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916404815 Original CRISPR ACTCCAGGTTCTCTGACTTT TGG (reversed) Intergenic
No off target data available for this crispr