ID: 916404816

View in Genome Browser
Species Human (GRCh38)
Location 1:164487719-164487741
Sequence TACTTGGATATCAGAACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916404816_916404821 10 Left 916404816 1:164487719-164487741 CCTGGAGTTCTGATATCCAAGTA No data
Right 916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG No data
916404816_916404818 -10 Left 916404816 1:164487719-164487741 CCTGGAGTTCTGATATCCAAGTA No data
Right 916404818 1:164487732-164487754 TATCCAAGTACAGGAGAAGAAGG No data
916404816_916404820 9 Left 916404816 1:164487719-164487741 CCTGGAGTTCTGATATCCAAGTA No data
Right 916404820 1:164487751-164487773 AAGGTTGTCCCAGCACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916404816 Original CRISPR TACTTGGATATCAGAACTCC AGG (reversed) Intergenic
No off target data available for this crispr