ID: 916404819

View in Genome Browser
Species Human (GRCh38)
Location 1:164487735-164487757
Sequence CAACCTTCTTCTCCTGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916404819_916404821 -6 Left 916404819 1:164487735-164487757 CCAAGTACAGGAGAAGAAGGTTG No data
Right 916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG No data
916404819_916404820 -7 Left 916404819 1:164487735-164487757 CCAAGTACAGGAGAAGAAGGTTG No data
Right 916404820 1:164487751-164487773 AAGGTTGTCCCAGCACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916404819 Original CRISPR CAACCTTCTTCTCCTGTACT TGG (reversed) Intergenic
No off target data available for this crispr