ID: 916404821

View in Genome Browser
Species Human (GRCh38)
Location 1:164487752-164487774
Sequence AGGTTGTCCCAGCACCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916404819_916404821 -6 Left 916404819 1:164487735-164487757 CCAAGTACAGGAGAAGAAGGTTG No data
Right 916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG No data
916404816_916404821 10 Left 916404816 1:164487719-164487741 CCTGGAGTTCTGATATCCAAGTA No data
Right 916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG No data
916404815_916404821 25 Left 916404815 1:164487704-164487726 CCAAAAGTCAGAGAACCTGGAGT No data
Right 916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916404821 Original CRISPR AGGTTGTCCCAGCACCAAGA GGG Intergenic
No off target data available for this crispr