ID: 916407162

View in Genome Browser
Species Human (GRCh38)
Location 1:164508906-164508928
Sequence TCTTAAATTCAGATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407162_916407165 2 Left 916407162 1:164508906-164508928 CCCAGCTTCATCTGAATTTAAGA No data
Right 916407165 1:164508931-164508953 TGAATATCCCCAGCTTTATTAGG No data
916407162_916407166 3 Left 916407162 1:164508906-164508928 CCCAGCTTCATCTGAATTTAAGA No data
Right 916407166 1:164508932-164508954 GAATATCCCCAGCTTTATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407162 Original CRISPR TCTTAAATTCAGATGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr