ID: 916407856

View in Genome Browser
Species Human (GRCh38)
Location 1:164515243-164515265
Sequence ACCCATTTCTGAAATTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407856_916407862 29 Left 916407856 1:164515243-164515265 CCATAATAATTTCAGAAATGGGT No data
Right 916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407856 Original CRISPR ACCCATTTCTGAAATTATTA TGG (reversed) Intergenic