ID: 916407858

View in Genome Browser
Species Human (GRCh38)
Location 1:164515268-164515290
Sequence TCAGCAGGGAGAGTCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407858_916407865 12 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407865 1:164515303-164515325 AGCCTGTGCTCCAGGAGAATGGG No data
916407858_916407868 26 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407858_916407864 11 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407864 1:164515302-164515324 CAGCCTGTGCTCCAGGAGAATGG No data
916407858_916407869 30 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407858_916407862 4 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407858 Original CRISPR TCAGCAGGGAGAGTCCTGGA AGG (reversed) Intergenic