ID: 916407859

View in Genome Browser
Species Human (GRCh38)
Location 1:164515272-164515294
Sequence TAAGTCAGCAGGGAGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407859_916407868 22 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407859_916407864 7 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407864 1:164515302-164515324 CAGCCTGTGCTCCAGGAGAATGG No data
916407859_916407862 0 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG No data
916407859_916407869 26 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407859_916407870 27 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data
916407859_916407865 8 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407865 1:164515303-164515325 AGCCTGTGCTCCAGGAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407859 Original CRISPR TAAGTCAGCAGGGAGAGTCC TGG (reversed) Intergenic