ID: 916407860

View in Genome Browser
Species Human (GRCh38)
Location 1:164515282-164515304
Sequence CTGGATGCACTAAGTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407860_916407865 -2 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407865 1:164515303-164515325 AGCCTGTGCTCCAGGAGAATGGG No data
916407860_916407869 16 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407860_916407870 17 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data
916407860_916407862 -10 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG No data
916407860_916407868 12 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407860_916407864 -3 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407864 1:164515302-164515324 CAGCCTGTGCTCCAGGAGAATGG No data
916407860_916407871 26 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407871 1:164515331-164515353 GAGTGAAGGTAGGGATCCCTTGG No data
916407860_916407872 30 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407872 1:164515335-164515357 GAAGGTAGGGATCCCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407860 Original CRISPR CTGGATGCACTAAGTCAGCA GGG (reversed) Intergenic