ID: 916407861

View in Genome Browser
Species Human (GRCh38)
Location 1:164515283-164515305
Sequence GCTGGATGCACTAAGTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407861_916407864 -4 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407864 1:164515302-164515324 CAGCCTGTGCTCCAGGAGAATGG No data
916407861_916407871 25 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407871 1:164515331-164515353 GAGTGAAGGTAGGGATCCCTTGG No data
916407861_916407872 29 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407872 1:164515335-164515357 GAAGGTAGGGATCCCTTGGAAGG No data
916407861_916407869 15 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407861_916407868 11 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407861_916407870 16 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data
916407861_916407865 -3 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407865 1:164515303-164515325 AGCCTGTGCTCCAGGAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407861 Original CRISPR GCTGGATGCACTAAGTCAGC AGG (reversed) Intergenic