ID: 916407862

View in Genome Browser
Species Human (GRCh38)
Location 1:164515295-164515317
Sequence GTGCATCCAGCCTGTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407859_916407862 0 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG No data
916407858_916407862 4 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG No data
916407860_916407862 -10 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG No data
916407856_916407862 29 Left 916407856 1:164515243-164515265 CCATAATAATTTCAGAAATGGGT No data
Right 916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407862 Original CRISPR GTGCATCCAGCCTGTGCTCC AGG Intergenic