ID: 916407863

View in Genome Browser
Species Human (GRCh38)
Location 1:164515301-164515323
Sequence CATTCTCCTGGAGCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407863_916407869 -3 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407863_916407870 -2 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data
916407863_916407868 -7 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407863_916407872 11 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407872 1:164515335-164515357 GAAGGTAGGGATCCCTTGGAAGG No data
916407863_916407871 7 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407871 1:164515331-164515353 GAGTGAAGGTAGGGATCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407863 Original CRISPR CATTCTCCTGGAGCACAGGC TGG (reversed) Intergenic