ID: 916407865

View in Genome Browser
Species Human (GRCh38)
Location 1:164515303-164515325
Sequence AGCCTGTGCTCCAGGAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407858_916407865 12 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407865 1:164515303-164515325 AGCCTGTGCTCCAGGAGAATGGG No data
916407859_916407865 8 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407865 1:164515303-164515325 AGCCTGTGCTCCAGGAGAATGGG No data
916407861_916407865 -3 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407865 1:164515303-164515325 AGCCTGTGCTCCAGGAGAATGGG No data
916407860_916407865 -2 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407865 1:164515303-164515325 AGCCTGTGCTCCAGGAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407865 Original CRISPR AGCCTGTGCTCCAGGAGAAT GGG Intergenic