ID: 916407868

View in Genome Browser
Species Human (GRCh38)
Location 1:164515317-164515339
Sequence GAGAATGGGCAGCAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407859_916407868 22 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407860_916407868 12 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407858_916407868 26 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407861_916407868 11 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data
916407863_916407868 -7 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407868 Original CRISPR GAGAATGGGCAGCAGAGTGA AGG Intergenic