ID: 916407869

View in Genome Browser
Species Human (GRCh38)
Location 1:164515321-164515343
Sequence ATGGGCAGCAGAGTGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407861_916407869 15 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407859_916407869 26 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407860_916407869 16 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407866_916407869 -7 Left 916407866 1:164515305-164515327 CCTGTGCTCCAGGAGAATGGGCA No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407858_916407869 30 Left 916407858 1:164515268-164515290 CCTTCCAGGACTCTCCCTGCTGA No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data
916407863_916407869 -3 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407869 1:164515321-164515343 ATGGGCAGCAGAGTGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407869 Original CRISPR ATGGGCAGCAGAGTGAAGGT AGG Intergenic