ID: 916407870

View in Genome Browser
Species Human (GRCh38)
Location 1:164515322-164515344
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407859_916407870 27 Left 916407859 1:164515272-164515294 CCAGGACTCTCCCTGCTGACTTA No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data
916407866_916407870 -6 Left 916407866 1:164515305-164515327 CCTGTGCTCCAGGAGAATGGGCA No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data
916407861_916407870 16 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data
916407860_916407870 17 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data
916407863_916407870 -2 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407870 1:164515322-164515344 TGGGCAGCAGAGTGAAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type