ID: 916407872

View in Genome Browser
Species Human (GRCh38)
Location 1:164515335-164515357
Sequence GAAGGTAGGGATCCCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916407860_916407872 30 Left 916407860 1:164515282-164515304 CCCTGCTGACTTAGTGCATCCAG No data
Right 916407872 1:164515335-164515357 GAAGGTAGGGATCCCTTGGAAGG No data
916407866_916407872 7 Left 916407866 1:164515305-164515327 CCTGTGCTCCAGGAGAATGGGCA No data
Right 916407872 1:164515335-164515357 GAAGGTAGGGATCCCTTGGAAGG No data
916407867_916407872 -1 Left 916407867 1:164515313-164515335 CCAGGAGAATGGGCAGCAGAGTG No data
Right 916407872 1:164515335-164515357 GAAGGTAGGGATCCCTTGGAAGG No data
916407861_916407872 29 Left 916407861 1:164515283-164515305 CCTGCTGACTTAGTGCATCCAGC No data
Right 916407872 1:164515335-164515357 GAAGGTAGGGATCCCTTGGAAGG No data
916407863_916407872 11 Left 916407863 1:164515301-164515323 CCAGCCTGTGCTCCAGGAGAATG No data
Right 916407872 1:164515335-164515357 GAAGGTAGGGATCCCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916407872 Original CRISPR GAAGGTAGGGATCCCTTGGA AGG Intergenic