ID: 916414036

View in Genome Browser
Species Human (GRCh38)
Location 1:164576388-164576410
Sequence CGGCGCCGCGCCGGCGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916414036_916414044 18 Left 916414036 1:164576388-164576410 CCCGGTCCGCCGGCGCGGCGCCG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 916414044 1:164576429-164576451 CTGCACCCTGCGCCTTGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916414036 Original CRISPR CGGCGCCGCGCCGGCGGACC GGG (reversed) Intronic
900162782 1:1232251-1232273 CCGCGCCGGGCCGGCGGCCCAGG - Exonic
900221565 1:1512038-1512060 CGGCGCCGCGACTGCCGAACAGG - Intergenic
900786929 1:4655230-4655252 CGGCGGCGCGCCGGCCGGCATGG + Exonic
901086145 1:6613543-6613565 AGGCTCCGCGGCGGCGGCCCCGG - Intronic
901443611 1:9293533-9293555 GGGCGCCCCGACGGGGGACCGGG - Intronic
902072178 1:13749498-13749520 CGGGGCCGGGCGGGCGGGCCGGG - Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
903034738 1:20486317-20486339 CGGGGCCGCGCCGGCCGGCCCGG + Intergenic
905202160 1:36322613-36322635 GGGCGCCCCGCCCGCGGCCCCGG - Exonic
909957765 1:81800983-81801005 GGCCGCCCCGCCGGCGGAGCCGG + Intronic
911440570 1:97921040-97921062 CGGCGGCGCGGGGGCGGAGCGGG + Intronic
911601193 1:99849998-99850020 CGGCTCCGGGCCGGGGGACCTGG - Intergenic
912416201 1:109509642-109509664 CCGCGCCAGGCCTGCGGACCTGG - Exonic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
914702932 1:150150341-150150363 CGCCGCGGCGCCGACGGAGCGGG - Intronic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
920278847 1:204828626-204828648 CGGGGGCGCGCCGGCCGCCCGGG + Intergenic
923007920 1:230067082-230067104 CCGCGCGGCGCCGCCGGCCCGGG + Intronic
923429227 1:233904941-233904963 CTGCGCCGCGCCGGCCGCCCCGG - Exonic
924560439 1:245154006-245154028 GGGCGCTGCGCCGGGGGACTGGG + Intergenic
1064418173 10:15168476-15168498 GGGCGGCGCGCTGGCGCACCGGG - Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1065883829 10:30059516-30059538 CGCCGCCGCTCCGGCCGGCCGGG + Exonic
1070129672 10:73647753-73647775 AGGCCCGGCGCCGGGGGACCCGG - Exonic
1070145887 10:73772984-73773006 CTGCGACGTGCCAGCGGACCGGG + Exonic
1070835589 10:79445281-79445303 CGGCGCCGCACCCCCGGAGCTGG - Exonic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1072591627 10:96832728-96832750 CGGCGCCGGGGCGCCGGGCCTGG - Intronic
1073340922 10:102744019-102744041 CGGCGCCGTGGCGGAGGAGCAGG + Exonic
1075106392 10:119542674-119542696 CGGCGGCGCGGCGGCTGAGCCGG + Exonic
1077043879 11:535921-535943 CGGCGCCGCGCTGCCGGCGCAGG - Intronic
1077266380 11:1652901-1652923 CGGCTCCGCGCTGGAGAACCGGG + Intergenic
1077629002 11:3798007-3798029 CCCAGCAGCGCCGGCGGACCGGG - Intronic
1078771803 11:14358722-14358744 CGCCGCCGCTCCGGCGCCCCGGG + Intronic
1080012397 11:27472225-27472247 CGGCGCCGCGCCGCTGGGCCCGG + Exonic
1081873037 11:46391846-46391868 CGGGGCCGCGCCGCCCGCCCCGG + Intergenic
1083670865 11:64299413-64299435 CGGCGGCGGGGCGGCGGGCCCGG - Exonic
1083970452 11:66070860-66070882 CGGCGGGGCGCCGGGGGAGCGGG + Intronic
1084295982 11:68213609-68213631 CGGCGACGCGGCGGCGGTGCGGG - Intronic
1085208108 11:74749193-74749215 CGCTGCCGCGCCCGCGGCCCAGG + Exonic
1093464951 12:19439772-19439794 CGGCCCCGCGCCGCCGAACCCGG - Exonic
1103954230 12:124567527-124567549 GGGCGGGGCGCCGGCGGACGCGG + Intronic
1104624314 12:130339080-130339102 CAGCGCAGCGGCGGCGGACGCGG - Intronic
1105000646 12:132687830-132687852 CCGCGCCGCTGCGGCCGACCTGG - Intronic
1111950772 13:94707496-94707518 CGGCTCGGCGCCGGCGCTCCCGG - Intergenic
1112402195 13:99086698-99086720 CGGCGCGGCGCGGGCGGGGCGGG + Intergenic
1116186798 14:41608299-41608321 CGGCTCCGCGCCCGGGGAGCGGG - Exonic
1116905182 14:50396930-50396952 CGGCCCCGCCCAGGCAGACCCGG - Intronic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1121368147 14:93333059-93333081 CAGCGCCGCGCAGGCGCCCCAGG - Intronic
1121754463 14:96391705-96391727 CGGCGCCGCGCGTGCAGCCCGGG - Intergenic
1122917487 14:104865669-104865691 CGCCGCCGCGGAGGCGGCCCTGG + Intronic
1123630637 15:22257888-22257910 CGACGCCGCGCCCGCGGCCCTGG + Intergenic
1124696797 15:31870447-31870469 CGGGGCCGGGCCCGCGGACCAGG - Intronic
1125535890 15:40441110-40441132 CGGGGCCGGGCGGGCGGAGCGGG - Intronic
1127117583 15:55743191-55743213 CAGCGCCGCGGCCGCGGGCCTGG + Intergenic
1130966998 15:88705241-88705263 CGGCTCCGCGCCGCCAGCCCGGG - Intergenic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1132251991 15:100341383-100341405 CGGCGACGCGGCGGCCGACGTGG - Exonic
1132498843 16:275891-275913 CGGCGCGGGGCCGGCGGCCATGG + Exonic
1133784240 16:8963018-8963040 CCGCCCCTCGCCCGCGGACCCGG + Intronic
1134149692 16:11796577-11796599 GGGCGCCGCCCGGGAGGACCGGG - Intronic
1135324920 16:21520245-21520267 CGGCGCGGCGCCGGCAGGCGAGG - Intergenic
1135479921 16:22814073-22814095 CCGCGCCGCGCCCAGGGACCTGG - Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136336405 16:29613520-29613542 CGGCGCGGCGCCGGCAGGCGAGG - Intergenic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136498761 16:30659435-30659457 CAGCGCCGCGCCTGCGACCCCGG + Exonic
1137614565 16:49838915-49838937 CGGGGCCGCCCCCGCGGGCCGGG + Intronic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1141608668 16:85169500-85169522 CCGCGCCGCGCCGCCCGCCCGGG - Intergenic
1141683298 16:85556392-85556414 CCGCGCGGCGCCGGCGCGCCCGG + Intergenic
1141972448 16:87492746-87492768 CGACGCCGCGCCCGCGGCCCGGG - Intergenic
1142412474 16:89923579-89923601 CAGCGCCGCGCCGGGCGGCCGGG + Intronic
1143637813 17:8176425-8176447 CGGCGCCGAGCCCGCGTACACGG - Intergenic
1146438963 17:32877048-32877070 CGGAGCCGCGCCGGCCGAGAAGG - Exonic
1150267881 17:63842599-63842621 CGGCGCCGTGGCTGCGGCCCTGG - Exonic
1152544112 17:80992168-80992190 CGGCGCCGCGCAGGAGACCCCGG - Intronic
1152861297 17:82698276-82698298 CAGCCCCGCGCCCCCGGACCGGG + Intronic
1157353987 18:46917111-46917133 CGGCGCGGGGGCGGCGGGCCTGG - Intronic
1158505548 18:58044045-58044067 CCGCGCCGCGCTGGAGGCCCCGG + Intergenic
1160024938 18:75209245-75209267 CGGCGCAGCCCCCGCGAACCCGG + Exonic
1160204792 18:76823135-76823157 CTGCGCGGCGCCGGCTGCCCCGG + Intronic
1160436753 18:78857741-78857763 CGGCTCCGCGCCGGCTTCCCCGG + Intergenic
1160763565 19:797562-797584 CGCCGCCGCGCCGGCCTCCCCGG + Intronic
1160766854 19:812646-812668 CGGCGCCACGCGGGCGGCCTGGG - Exonic
1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG + Intronic
1160991697 19:1862904-1862926 CGCCGCCGCGCCGGCCGGCAGGG - Intronic
1162470952 19:10871741-10871763 CGGCGCGGGGTCGGCGGTCCCGG + Exonic
1162953536 19:14085744-14085766 CGGAGCCGCGCCGCCGCGCCGGG + Exonic
1163027044 19:14518477-14518499 CGGCGCCGCGGGGGCGGGCGGGG - Intronic
1163138775 19:15332350-15332372 CGGCGCCGCGCAGGCAGCTCGGG - Intronic
1163158155 19:15449971-15449993 CGGCGGCGCGCCGGGGGGGCGGG - Intergenic
1163501773 19:17680402-17680424 GGGAGGCGCGCCGGCGGACAGGG + Intronic
1163715628 19:18870548-18870570 CGGCCCCGCCCCCGTGGACCCGG - Exonic
1165420059 19:35718078-35718100 CGGCGCCCCGCGGCCGGCCCGGG - Exonic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
925988781 2:9236967-9236989 CGGAGACGGGCAGGCGGACCAGG + Intronic
927652343 2:24920201-24920223 CCGCGCGGCGCCGGCGGCTCCGG + Intergenic
928964920 2:36966637-36966659 CTGCGGCGCGCTGGCGGCCCGGG + Intergenic
929188693 2:39120704-39120726 CGGGGCGGCGCCGGCGGGCCGGG - Intronic
929452995 2:42048658-42048680 CACCGCCGGGCAGGCGGACCCGG - Exonic
932887487 2:75560729-75560751 CGGGGCCGAGCAGGGGGACCCGG + Intronic
934296836 2:91749090-91749112 CAGCGCCGCGGCGGCGCCCCGGG + Intergenic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
936433227 2:112482120-112482142 CGGGGCCGCGCCGGCGGGGGCGG + Intergenic
939629451 2:144516079-144516101 CGGCCCCGCGCCGGGTGATCGGG + Intronic
940454054 2:153873312-153873334 CAGCGCAGCGCCCTCGGACCCGG - Intronic
940883256 2:158968340-158968362 AGGCGCAGCCCCGGGGGACCCGG + Intergenic
944413476 2:199463086-199463108 CGGCCGCGGGCCGGGGGACCGGG + Intronic
947353617 2:229271245-229271267 CGGCCGCGCGCCGGCTGTCCTGG + Exonic
947418571 2:229921958-229921980 CGGCGCGGCGGCGGCGGCTCCGG + Exonic
1169558145 20:6770168-6770190 CCGCGCCGCCCAGGAGGACCTGG - Exonic
1170558066 20:17531355-17531377 CGGCGCCGAGCCGGCTCTCCAGG + Exonic
1170578612 20:17681949-17681971 CGGCGCAGCGCGGCCGGCCCCGG + Intronic
1170639363 20:18138076-18138098 CGACGCCGCGCGCGCGGGCCCGG - Intronic
1170889804 20:20367873-20367895 CGGCGCCGGGCGGGGCGACCAGG + Intergenic
1171473561 20:25390614-25390636 CAGCGCCGCGGCGGCCGAGCCGG + Exonic
1173548195 20:43914939-43914961 CGGGGCCGAGCCGGCCGGCCTGG + Exonic
1175429502 20:58891621-58891643 CAGCGCCGGGCGGGCGGGCCGGG - Intronic
1175887917 20:62302828-62302850 CGCCGGCGCGGGGGCGGACCGGG + Intronic
1175927036 20:62476039-62476061 CGGCGCGGCGGGGGCGGGCCGGG - Intergenic
1176194523 20:63831131-63831153 CGGCGCCGGCCCGGCGGCCGCGG - Intronic
1176198021 20:63846531-63846553 TGGAGCCGGGCCGGCGGGCCGGG + Intergenic
1176549076 21:8213727-8213749 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176556970 21:8257947-8257969 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176568008 21:8396765-8396787 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176575912 21:8440984-8441006 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1178518185 21:33266276-33266298 CCGCGCCTCGCGGGTGGACCCGG + Intronic
1179113984 21:38472977-38472999 CGGCTCCCCGCCTGCAGACCCGG + Intronic
1179495231 21:41767056-41767078 CAGCGCCGCGGCGGCTGCCCAGG + Exonic
1180216083 21:46324522-46324544 CGGCGCCTCTCGGGCGGGCCGGG + Intronic
1180614811 22:17120359-17120381 CTGCGCCGCCCCGACGGCCCCGG + Exonic
1181057871 22:20268383-20268405 CCGCGCGGCGCCGGTGCACCGGG - Exonic
1181085486 22:20437701-20437723 CGGCGCGGCGCCGGGGAGCCGGG - Exonic
1183524999 22:38317491-38317513 CGGGGCGGCGGCGGCGGGCCGGG - Intronic
1183683774 22:39350215-39350237 CGGCGGCGCGGCGGCGGGCGAGG + Intronic
1184472241 22:44702447-44702469 GGGCGCGGCGCAGGCGGCCCGGG + Intronic
1184523779 22:45009799-45009821 CCGGGCCGCGCCGGCAGCCCGGG - Intronic
1203253963 22_KI270733v1_random:130042-130064 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203262019 22_KI270733v1_random:175121-175143 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
950730088 3:14948580-14948602 CGGCCCCGCCCCCGCCGACCCGG - Intronic
952241279 3:31533136-31533158 CGGCGCGGCGCCGCCGAAGCCGG + Exonic
954615718 3:51967813-51967835 AGGCGCCGGGCGGGCGGCCCGGG - Intronic
954912699 3:54122400-54122422 CGGCCCCGCCTCGGCGGCCCCGG - Intergenic
956605063 3:71065262-71065284 CGCCGCCCCGCCGGCAGCCCCGG - Intronic
956761301 3:72447209-72447231 CGGCGCCGCGAGGGCGGAGGCGG + Intergenic
960101338 3:113746258-113746280 CGGCGGCGCGCCGGCGCGCGAGG - Exonic
961081559 3:124033034-124033056 CGGCCCCGCGCCGGCCTCCCGGG - Intergenic
961359426 3:126357567-126357589 GGGAGCCGCGCGGGCGGGCCGGG - Intergenic
961665025 3:128489280-128489302 CGGGGGCGCGCCCGCGGAGCTGG - Intronic
965590365 3:170356816-170356838 CCGCCCCGCCCCGGCGGCCCCGG - Intergenic
966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG + Intergenic
967272634 3:187743798-187743820 AGGCGCGGCGGCGGCGGCCCGGG - Intronic
968636668 4:1684431-1684453 CCGCGCCGCGCCGACGGAGGGGG + Intergenic
968850489 4:3074617-3074639 CGGGGCCGCGCCGGCGGAGGCGG - Intergenic
971257892 4:25030734-25030756 CCGCGCCGCGCGCTCGGACCCGG + Exonic
973996829 4:56467300-56467322 CGGCCCCGCACCGTGGGACCAGG + Exonic
978741815 4:112145637-112145659 CGGGGACGCGCTGGCGGAGCGGG + Exonic
979674650 4:123398275-123398297 CGGCTCCGCGCGGCCGGGCCCGG - Intronic
992611217 5:78510066-78510088 CGGCGTGGAGCCGGCGGGCCCGG - Exonic
992627586 5:78648945-78648967 GGGCGGCGGGCGGGCGGACCAGG + Intronic
994197448 5:96936006-96936028 CGGCGCCGCTCCGCCGTTCCGGG - Exonic
995462556 5:112419257-112419279 CGGGGAAGCGCCGGCGGAACTGG + Exonic
1001065115 5:168529687-168529709 CGCCGCCGCGCCCCCGGCCCCGG - Exonic
1002160721 5:177312526-177312548 CGGCGGAGGGGCGGCGGACCCGG + Intronic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1006535609 6:34696648-34696670 CGCCGCCGCGCCGCCGGGCCCGG + Exonic
1006535614 6:34696656-34696678 CGCCGCCGGGCCCGGGGACCTGG + Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007327654 6:41073808-41073830 CGGCGCCGGGCCGGAGACCCGGG - Intronic
1013170902 6:107635394-107635416 CAGCGCCGGGCCTGAGGACCTGG + Exonic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1017954932 6:159169625-159169647 GCGCGCCGCGCCGGCTGTCCTGG + Exonic
1019461325 7:1160417-1160439 CGGCTCCGCGCAGGCGCAGCCGG + Intronic
1019689578 7:2403320-2403342 TGACTCCGCCCCGGCGGACCGGG - Intergenic
1019989649 7:4682550-4682572 CGGCGCCGCGCCCGCGACCGCGG - Exonic
1020066178 7:5190218-5190240 CGGGGCCGCGCAGGCGTACCGGG + Exonic
1020080275 7:5282949-5282971 CGTCGCCGCGCTCGTGGACCGGG + Exonic
1020105716 7:5421395-5421417 CGGCGGCGGGCCCGCGGCCCGGG + Exonic
1021085964 7:16421280-16421302 CAGCGCCAGGCCGGCGGAGCCGG - Exonic
1022943188 7:35258362-35258384 AGGCGCCGCGCCTTGGGACCCGG - Intergenic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1026732753 7:72925568-72925590 CGCCGCCGCTCCGGAGGGCCAGG + Intronic
1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG + Exonic
1029098392 7:98107181-98107203 CGCCGCAACGCCGGCGGCCCCGG - Exonic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034445935 7:151114526-151114548 CCGCGCCGCGCCGCCGTTCCCGG + Intronic
1038632941 8:29262941-29262963 CGCCTCCGCCCCGGCGGCCCAGG + Intronic
1038726071 8:30083292-30083314 CGCCGCCGCGCCCGCGGGCGGGG + Intergenic
1038789719 8:30657899-30657921 CGGCGGCGCGCCTGCGTCCCAGG + Intronic
1040501457 8:48008679-48008701 CGGCCGCGCGCCGGCGGGCTGGG + Intronic
1041910704 8:63085914-63085936 CGGCGCTGCGGCGCCGGGCCCGG - Exonic
1049406220 8:142452847-142452869 CGGCCCCGCGCCGGCCGCCTGGG - Intronic
1049649856 8:143760875-143760897 CATCGCCGCGCAGGCGGGCCCGG + Intergenic
1049973620 9:842006-842028 CGGCTCCGGGGCGTCGGACCTGG + Exonic
1053066321 9:35071995-35072017 GGGCGCCGCGCCGGCGGAGTGGG + Intronic
1057489637 9:95511119-95511141 CGGCCCCGCGCTGGCTGCCCGGG + Intronic
1060793225 9:126499378-126499400 CGGCGCTGCGCAGCTGGACCGGG + Intronic
1060811726 9:126614258-126614280 CGGCGTCGTGCGGGCGGGCCGGG - Intergenic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1061975958 9:134068150-134068172 GGGCGCGGCGCCGGCGGGGCCGG - Intronic
1062567286 9:137168883-137168905 CTGTGCCTCGCCCGCGGACCCGG - Exonic
1203470363 Un_GL000220v1:113186-113208 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203478184 Un_GL000220v1:157158-157180 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1191025460 X:55908730-55908752 CGGCCCCGCCCCGTCGGCCCAGG + Intergenic
1198398909 X:136251202-136251224 CTGCGCCGCTCCGACGGCCCGGG + Intronic
1200216864 X:154371838-154371860 CGCTGCCGGGCCGGCGGACGGGG - Intronic