ID: 916414040

View in Genome Browser
Species Human (GRCh38)
Location 1:164576400-164576422
Sequence GCGCGGCGCCGCGTCGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916414034_916414040 -5 Left 916414034 1:164576382-164576404 CCACTGCCCGGTCCGCCGGCGCG 0: 1
1: 0
2: 1
3: 23
4: 2166
Right 916414040 1:164576400-164576422 GCGCGGCGCCGCGTCGCACCCGG 0: 1
1: 0
2: 1
3: 15
4: 95
916414031_916414040 0 Left 916414031 1:164576377-164576399 CCCGGCCACTGCCCGGTCCGCCG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 916414040 1:164576400-164576422 GCGCGGCGCCGCGTCGCACCCGG 0: 1
1: 0
2: 1
3: 15
4: 95
916414032_916414040 -1 Left 916414032 1:164576378-164576400 CCGGCCACTGCCCGGTCCGCCGG 0: 1
1: 1
2: 2
3: 15
4: 180
Right 916414040 1:164576400-164576422 GCGCGGCGCCGCGTCGCACCCGG 0: 1
1: 0
2: 1
3: 15
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916414040 Original CRISPR GCGCGGCGCCGCGTCGCACC CGG Intronic