ID: 916414331

View in Genome Browser
Species Human (GRCh38)
Location 1:164578581-164578603
Sequence GGCCCCTGGAAGCTCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916414331_916414337 7 Left 916414331 1:164578581-164578603 CCCTCAAGGAGCTTCCAGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 258
Right 916414337 1:164578611-164578633 TGGGCAGAATCAATGTGACATGG 0: 1
1: 0
2: 0
3: 14
4: 163
916414331_916414339 12 Left 916414331 1:164578581-164578603 CCCTCAAGGAGCTTCCAGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 258
Right 916414339 1:164578616-164578638 AGAATCAATGTGACATGGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 169
916414331_916414338 8 Left 916414331 1:164578581-164578603 CCCTCAAGGAGCTTCCAGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 258
Right 916414338 1:164578612-164578634 GGGCAGAATCAATGTGACATGGG 0: 1
1: 0
2: 2
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916414331 Original CRISPR GGCCCCTGGAAGCTCCTTGA GGG (reversed) Intronic
900080578 1:854030-854052 GTCCTCTGTAAGCTCCTAGAAGG + Intergenic
900172142 1:1274241-1274263 GGCCCCTGGAGGCTCAGTGGAGG + Intergenic
900315067 1:2052291-2052313 GGCCCCTGGGAGCACTTTGGTGG + Intronic
900626228 1:3609938-3609960 TGCCCCTGGAAGCCCCTGGCTGG + Intronic
900803660 1:4753264-4753286 AGCCCCTGGAAGCTACATTAAGG + Intronic
901693771 1:10991405-10991427 GGCCCCTGTCAGCTTCTTGATGG + Intergenic
902408294 1:16198528-16198550 GGCTCCTGGATGGTCCTGGAGGG - Exonic
902410970 1:16211406-16211428 GGGTTCTGGAAGCTCCTGGAGGG + Intronic
902458635 1:16554421-16554443 GGCCCATGGAAGGTACCTGAGGG + Intergenic
902493522 1:16853495-16853517 GGCCCATGGAAGGTACCTGAGGG - Intronic
902763283 1:18598314-18598336 GGCTCCTGGAGGGTCCTTAAAGG - Intergenic
903003435 1:20282635-20282657 GGCCCCAGGCAGCTCACTGATGG - Intergenic
903151820 1:21415181-21415203 GGCCCATGGAAGGTACCTGAGGG + Intergenic
903691717 1:25178799-25178821 GGAGCCTGTAAGCGCCTTGAAGG - Intergenic
903739863 1:25552445-25552467 GGCCCCTGGAAGCTGATTCCTGG + Intronic
907240393 1:53077839-53077861 GGGCCCGGGAAGCTCCTTCAGGG + Intronic
908408437 1:63838375-63838397 GTCCCCTGGAAGCTCTTCAAGGG - Intronic
909008182 1:70301941-70301963 ATCCCCAGGAAGCTCCTTTAAGG + Intronic
911179290 1:94847033-94847055 GCTCCCTGGAAGCTCGCTGAAGG + Intronic
911360985 1:96875940-96875962 GGGCAGTGGAAGCTCCGTGAAGG + Intergenic
911566022 1:99464467-99464489 GGGCCATGGCAGCTCCTTCATGG + Intergenic
913316832 1:117560923-117560945 GGCCCCTGGAATAACCTTGGAGG + Intergenic
913607016 1:120475945-120475967 GGCCCATGGAAGGTACCTGAGGG - Intergenic
914209419 1:145564199-145564221 GGCCCATGGAAGGTACCTGAGGG + Intergenic
914240455 1:145849520-145849542 GGCCCCTGGGGGGGCCTTGAGGG - Exonic
914268339 1:146056567-146056589 GGCCCATGGAAGGTACCTGAGGG + Intergenic
914368756 1:147004294-147004316 GGCCCATGGAAGGTACCTGAGGG - Intergenic
914584178 1:149045893-149045915 GGCCCATGGAAGGTACCTGAGGG + Intronic
915281960 1:154829050-154829072 AGCTCCTGGGAGCTCCTGGATGG - Intronic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG + Intergenic
917118710 1:171627218-171627240 GTCCTCTCCAAGCTCCTTGACGG + Intergenic
918251637 1:182708352-182708374 GGCCCCTGCAGTGTCCTTGAAGG + Intergenic
920261290 1:204689710-204689732 GGATCCTGGGAGCTCCCTGAGGG - Intergenic
920337445 1:205254674-205254696 GGCACCTGGCAGCTCCCTAATGG - Intronic
920352515 1:205346853-205346875 AGCCGCTGGAATCTCCTTGGTGG - Intronic
923022845 1:230178304-230178326 GGCCCCTGGCAGTACCTGGAGGG - Exonic
923868468 1:237965058-237965080 GGTGCCTGGAATTTCCTTGAAGG + Intergenic
924826876 1:247549044-247549066 GGCCCCTGGCAGCTCGTGGTTGG + Intronic
1064933783 10:20657131-20657153 GGCCCCAGGATGCTACTAGAGGG - Intergenic
1065843651 10:29726946-29726968 CGCCACTGTAAGCTCCGTGAAGG + Intronic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067683480 10:48454309-48454331 GGGCCCTGGCCACTCCTTGAGGG - Intronic
1067720257 10:48722792-48722814 GACCCCAGGAAGCTCCTGGCAGG + Intronic
1071315258 10:84389389-84389411 GTCTCCTGGCAGTTCCTTGAGGG + Intronic
1073572948 10:104596361-104596383 GGCACCTGGAAGATCCCAGAAGG + Intergenic
1074823120 10:117196382-117196404 GTCTCCTGGAGGTTCCTTGAGGG + Intergenic
1075212964 10:120507236-120507258 GGATCCTGGAAGGTCCCTGAGGG - Intronic
1076798392 10:132809688-132809710 GGTCCCGGGAAGCTCCTTTCTGG + Intronic
1076803342 10:132843252-132843274 TTCCCCTGGAAGCTTCTGGAAGG - Intronic
1077808485 11:5613317-5613339 GGGCACTTGAAGCTCCTTCATGG + Intronic
1078367576 11:10719417-10719439 GGCACCTGGAAGCCCCATGGAGG - Intergenic
1078589921 11:12631417-12631439 AGCCCCTGGATGTTCCTTTATGG - Intergenic
1080383270 11:31795947-31795969 GGCCCCTAGGAGCGCCTTGGTGG + Intronic
1082700542 11:56424401-56424423 AGACCCTGGGACCTCCTTGAAGG + Intergenic
1082810788 11:57477638-57477660 GCCACCAGGAAGCTCTTTGATGG - Intergenic
1084106405 11:66983674-66983696 GGAGACTGGAAACTCCTTGAGGG + Intergenic
1084837439 11:71813378-71813400 GGCCTCTGGGCGCTCCTTGGTGG + Intergenic
1085384344 11:76148569-76148591 GTCCCCTGGGAGCTCTGTGAAGG + Intergenic
1086520658 11:87664656-87664678 GACATCTGTAAGCTCCTTGAGGG - Intergenic
1090036311 11:123252652-123252674 GGGTCCTGGAAGCTCCTGGAGGG + Intergenic
1090284990 11:125492313-125492335 GACCCCTGCAGGCTCTTTGAAGG + Intronic
1090732450 11:129583433-129583455 GGCTCCTGGACGCCCCTTGCTGG - Intergenic
1092024978 12:5232678-5232700 TGCCCCTGGATGCTCCTTCTGGG - Intergenic
1092401261 12:8180695-8180717 GGCCTCTGGGCGCTCCTTGGTGG - Intronic
1094503242 12:31038570-31038592 GCCACCTGGAAGCTCCTTGGAGG - Intergenic
1094775677 12:33724437-33724459 GACCCCTGGAAGGTCCATGGAGG - Intergenic
1095123984 12:38453474-38453496 GGCCTCTGAAAGCTCCTTTAAGG - Intergenic
1096183525 12:49564352-49564374 GACTCCTGGAGGCTCCTTGGGGG - Intronic
1096503081 12:52077200-52077222 GATCTCTGGGAGCTCCTTGATGG + Exonic
1097312287 12:58133290-58133312 GGCACTTTGAAGCTCCTTTATGG - Intergenic
1101721811 12:107357028-107357050 GGGTCCTCTAAGCTCCTTGAGGG - Intronic
1102019191 12:109669921-109669943 GCCTACTGGACGCTCCTTGAAGG - Intergenic
1102439242 12:112948843-112948865 AGGCCCTGGAAGGTCATTGAAGG - Exonic
1102967860 12:117141815-117141837 GGCTCATGGAAGCTCCCAGATGG + Intergenic
1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG + Intronic
1104634118 12:130427084-130427106 GGCCCCTGGCAGGGCCTTGGGGG - Intronic
1104823670 12:131693474-131693496 GGCCCCTGGAAGACACATGAGGG - Intergenic
1106228030 13:27799784-27799806 GGGCCCTGGAATTTCCTTGGTGG - Intergenic
1106393736 13:29360358-29360380 GTCCCCTGGCAGCTCCTTTTTGG + Intronic
1110990517 13:82038103-82038125 GGCCCCTGGAAGTTTCTCCAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1115439275 14:33413336-33413358 GGTCCCTGGAAGCTGCATGAGGG + Intronic
1116991806 14:51285173-51285195 ATCACCTGGAAGCTCCTTGAGGG + Intergenic
1118813538 14:69292564-69292586 GGCCCGTGGAAAGTCCTTTAAGG + Intronic
1119558367 14:75570532-75570554 GGACACTGTAAGCTCCATGAAGG + Intergenic
1121102771 14:91261483-91261505 GACCCCTGGCAGGGCCTTGAAGG + Intergenic
1122847727 14:104509983-104510005 GGCCACAGGAGGCTCCGTGAAGG + Intronic
1122986112 14:105212450-105212472 GGCACCAGGCAGCTCCTTGAGGG - Intronic
1127308756 15:57732669-57732691 GGCCTATGGAAACTCCTGGATGG - Intronic
1129231107 15:74197641-74197663 GGGCCCTGGAAGATCCTGGGTGG - Intronic
1130094020 15:80842889-80842911 GACCCCTGGGACCTCCTGGAAGG - Intronic
1130603370 15:85293450-85293472 GGATCCTGGGAACTCCTTGAGGG - Intergenic
1130994318 15:88895460-88895482 GTCCCCAGGCAGCTCCTCGACGG + Exonic
1131927171 15:97397786-97397808 AGCCTCAGGAAGCTCCTCGAAGG - Intergenic
1132461355 16:56721-56743 GCCCCAAGGAAGCTCCTTGGAGG - Intronic
1132648045 16:1008041-1008063 GGACCCAGGAAGCCCCTTCAAGG + Intergenic
1132785213 16:1653228-1653250 TTCTCCTGGAAGTTCCTTGAGGG - Intronic
1132975884 16:2711020-2711042 GGCCCCTGCCAGCTCCAGGAGGG - Intergenic
1133976104 16:10600825-10600847 GTCCCCTGGAAGTTCCTGGAGGG + Intergenic
1135402892 16:22178378-22178400 GGCCCCTTGGAGCTCCTGGCAGG + Intronic
1136860704 16:33700144-33700166 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1137252679 16:46751503-46751525 TGCGGCTGGAAGCTCCCTGAGGG + Intronic
1137310229 16:47248919-47248941 TGCCCCTGTGAGCTTCTTGAAGG + Intronic
1137539586 16:49353144-49353166 GCTCCCTGGAAGCTTCTTGGGGG - Intergenic
1139839887 16:69869840-69869862 GTCAACAGGAAGCTCCTTGAGGG - Intronic
1141113276 16:81287764-81287786 GGCACCTGGAAGCTCCTGCCTGG - Intronic
1203122203 16_KI270728v1_random:1548327-1548349 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1143179187 17:4973655-4973677 GGCCCATGGAAGCCCCTTCCGGG - Exonic
1144619227 17:16805837-16805859 GGCTTCTGGAAGCTTCTAGAAGG + Intergenic
1144670909 17:17132111-17132133 GGCCCCTGTGAGCTCCTTATGGG - Intronic
1144893470 17:18509858-18509880 GGCTTCTGGAAGCTTCTAGAAGG - Intergenic
1145138754 17:20434416-20434438 GGCTTCTGGAAGCTTCTAGAAGG + Intergenic
1147055955 17:37835307-37835329 GGCTTCTGGAAGCTTCTAGAAGG - Intergenic
1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG + Intronic
1151192197 17:72406751-72406773 GGCACATGGAAGTTCCTGGAGGG + Intergenic
1151540981 17:74764401-74764423 GGCCCCTGGAAGTCCCTAGCTGG + Intronic
1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG + Exonic
1152066348 17:78114701-78114723 GGCCCATGGTCTCTCCTTGAAGG - Intronic
1152265195 17:79290078-79290100 AGGCACTGGAAGCTCCTTGGAGG + Intronic
1152308070 17:79532635-79532657 GGCCCCTGGCCGCTCCTTCCTGG - Intergenic
1152541176 17:80976701-80976723 GTCTCCTGGCAGTTCCTTGAGGG - Intergenic
1153586629 18:6627860-6627882 GGCAGCTGGAAGCTTCTGGAAGG - Intergenic
1153993294 18:10418890-10418912 TGCCCCAGAAAGGTCCTTGATGG + Intergenic
1157114559 18:44850958-44850980 GGAGACTGGGAGCTCCTTGAAGG - Intronic
1158695174 18:59697300-59697322 GGCCCCTGGCAGCTCCTCCCCGG + Exonic
1160932215 19:1576230-1576252 GGCCACTGGAAGCTGCTTTCTGG - Intronic
1161200231 19:3010541-3010563 GCCACCTGGGAGTTCCTTGAGGG + Intronic
1162034543 19:7932001-7932023 GGCCTCTGGAAGGCCCTTCATGG - Intronic
1162139487 19:8577329-8577351 GGCTCCTGGAGGCTCCTGAATGG + Exonic
1163622387 19:18368824-18368846 GGCCTCTGGGAGCTGCGTGACGG + Exonic
1163629895 19:18412947-18412969 GACCCCAGGAAGCTCCTGGTAGG + Intergenic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1164599258 19:29549801-29549823 GGCCCCAGGAAGCTCGGAGACGG + Intronic
1166851531 19:45763749-45763771 GGCAGGTGGCAGCTCCTTGAAGG - Intronic
1167579336 19:50332607-50332629 GGCTTCTGGAAGCTTCATGAGGG + Intronic
926164106 2:10507422-10507444 GGCCCCTGGAGGCTCCAGCAGGG - Intergenic
928398461 2:30961035-30961057 GGCCTCTGGGGGCTCCTTGAGGG - Intronic
929989282 2:46771729-46771751 TGTTCCTGGGAGCTCCTTGAAGG + Intergenic
930014419 2:46960523-46960545 GGCCCCTGCAAGCTCCTGGGTGG - Intronic
932401522 2:71483854-71483876 GGCTCCTGGAAGCCCCAGGATGG + Intronic
932478829 2:72025970-72025992 GTTTCCTGAAAGCTCCTTGAGGG + Intergenic
932773562 2:74514540-74514562 GGCCCCTGGAGCTTCCTTGCTGG - Exonic
934459082 2:94201297-94201319 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG + Intergenic
934858052 2:97741252-97741274 GTCCCCTGGAAGGTGCTTGCAGG + Intergenic
937411981 2:121684623-121684645 GGCTCTTGTCAGCTCCTTGAAGG + Intergenic
937441797 2:121921690-121921712 TGCACCAGGAAGCTCCTTCAGGG - Intergenic
939983865 2:148811853-148811875 TTCTCCTCGAAGCTCCTTGAGGG + Intergenic
945055731 2:205867237-205867259 GGCACCTGGTAGCTCTTTGCTGG - Intergenic
945440983 2:209879284-209879306 GGCCCCTGGAAGTTCCAGGATGG - Intronic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946178494 2:217936402-217936424 GGCCCCTGAAATCTCCTTCCTGG - Intronic
1171956375 20:31466933-31466955 TGACGCTGGAAGCTCCTTGAGGG - Intronic
1172788792 20:37488023-37488045 GGCCCATGGAAGGTCACTGAAGG - Intergenic
1173331643 20:42080393-42080415 GCCCCCTGCAACCTCCTTCAGGG - Exonic
1174506990 20:51023261-51023283 GGCGCCTGGACGCCCCGTGACGG - Intergenic
1176086019 20:63295900-63295922 GGCACCTGCAAGCTCCTGGGAGG + Intronic
1176362166 21:6006696-6006718 GGCTCCTGGACCCTCCCTGAGGG + Intergenic
1177975526 21:27845100-27845122 GCCTCCTGGAAGCTTCTTGAGGG + Intergenic
1179761352 21:43531849-43531871 GGCTCCTGGACCCTCCCTGAGGG - Intronic
1181357132 22:22305172-22305194 GGCGACTGGAAGTTCCTGGAAGG + Intergenic
1181668048 22:24411993-24412015 GGGCCCAAGAAGCTCCGTGAAGG + Intronic
1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG + Intergenic
1182759003 22:32706897-32706919 GGCCCCTGGAATTCCCTAGAGGG + Intronic
1183376209 22:37467069-37467091 GGCCCCTGCACACTCCTTGCTGG + Intergenic
1184568516 22:45308089-45308111 GGGGCCTGGGAGCTCCATGAGGG + Intergenic
1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG + Intergenic
1184983845 22:48115648-48115670 GGCCTTTGGAAGCTGCGTGAAGG - Intergenic
949933414 3:9098210-9098232 CTGCACTGGAAGCTCCTTGAGGG + Intronic
951297693 3:20959439-20959461 GGCCCCTGTTGGATCCTTGAAGG - Intergenic
951432897 3:22628553-22628575 GGCTGCTCTAAGCTCCTTGAGGG + Intergenic
951993849 3:28705092-28705114 GCCATCTGGAAGCTCTTTGAGGG + Intergenic
953465316 3:43114667-43114689 GGCCCCTGGAAGGGCATTGTTGG + Intergenic
953480504 3:43247512-43247534 GGCTCCTGGCAGCTCTTTGGGGG + Intergenic
953775570 3:45813759-45813781 TGTCACTGTAAGCTCCTTGAGGG + Intergenic
954292401 3:49656509-49656531 GGCTCCTGCAGCCTCCTTGATGG - Exonic
954407602 3:50354179-50354201 GACCCCTGGCTGCTCCCTGAGGG + Intronic
954616259 3:51970113-51970135 GGCCCCTGGCAGCTTCCTGGCGG - Exonic
955029219 3:55200294-55200316 GGTCCCTGGAACATCCTTTACGG + Intergenic
959999527 3:112716042-112716064 GGCCACAGGTAGCTTCTTGAGGG + Intergenic
960774363 3:121232097-121232119 TGCCACTGGCAGCTCCTTCAGGG + Intronic
962921524 3:139954471-139954493 GGACTCTGAAGGCTCCTTGAGGG + Intronic
965539974 3:169862244-169862266 GGCCATTTGCAGCTCCTTGATGG - Intronic
966656686 3:182366279-182366301 GGGTCCTGGAAGCTCCTTGCTGG + Intergenic
967284757 3:187858270-187858292 GGCCCCTGGAAGCTCCGCCGGGG - Intergenic
967910298 3:194537233-194537255 AGCCACTGTGAGCTCCTTGAGGG + Intergenic
968576345 4:1367977-1367999 GGCCGCTGCAATCTCCTTCATGG + Intronic
968605858 4:1534995-1535017 GGCCCCTAGAACCTCCTCCAGGG + Intergenic
968688421 4:1976903-1976925 AGCCCCTGGAACCTCCAGGAGGG + Intronic
969778853 4:9380883-9380905 GGCCTCTGGGTGCTCCTTGGTGG + Intergenic
972124753 4:35749509-35749531 GCCGTCTGTAAGCTCCTTGAAGG + Intergenic
972328439 4:38040706-38040728 GGCCCCTGGGAGCCCTTTGTGGG + Intronic
975579055 4:75890797-75890819 GGCAGCTGGAAGCTGCTGGAAGG - Intronic
975761496 4:77624768-77624790 GGGCCCTGCATGCTCCTTGTAGG - Intergenic
977564810 4:98569928-98569950 GGACCATGTAAGTTCCTTGAAGG - Intronic
981751020 4:148092367-148092389 GCGGCCTGCAAGCTCCTTGATGG + Intronic
982196309 4:152918998-152919020 GGCCCATAGAAGCCTCTTGAGGG + Intergenic
983262192 4:165469398-165469420 GGCCCCTGGAAGCTGCCGGCTGG + Intronic
985527191 5:412015-412037 GGCCCCGGGAAGCTGCTGCAGGG + Intronic
985801320 5:2006965-2006987 GGCACCTGCAAGCTCCTTCGTGG - Intergenic
992590931 5:78294945-78294967 GGGCTCTGGAAACTCCTTAACGG - Intergenic
997567634 5:134901950-134901972 AGCCACTGGAAGCTGCATGAAGG - Intergenic
997589391 5:135063654-135063676 AGCCCCAGGCAGCTCCTAGAGGG + Intronic
998019524 5:138757692-138757714 GAGCCTTGTAAGCTCCTTGAAGG + Intronic
998050992 5:139035372-139035394 GTCCCTTGGCAGTTCCTTGAGGG + Intronic
1000119089 5:158179684-158179706 GGCCCCTGGAAACTGCATCATGG + Intergenic
1000464631 5:161560547-161560569 TCCCCCTGTAAGCTTCTTGAGGG - Intronic
1001318252 5:170659901-170659923 GGCCCCTTGGAGCTCCTTCCAGG + Intronic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1002494655 5:179603513-179603535 ACCCCCAGGGAGCTCCTTGAGGG + Intronic
1003378844 6:5604075-5604097 GGCTCCTAGCAGCTCCTTAAAGG + Intronic
1004521471 6:16364877-16364899 GTGGACTGGAAGCTCCTTGAAGG - Intronic
1006160651 6:32038967-32038989 GGTCCCTGGAAGCTCTTGGGGGG + Intronic
1006472346 6:34236051-34236073 GTCGCCTGGAAGCGCTTTGAGGG - Intergenic
1006822347 6:36907426-36907448 GGCACCAGGAAGCTCCCTGATGG + Intronic
1012214463 6:96564858-96564880 GTACCCTGAAAGCTCATTGAAGG + Intronic
1012863441 6:104589493-104589515 GTCAACTGAAAGCTCCTTGAAGG + Intergenic
1013901309 6:115160148-115160170 GGCCTCTGGAAGCTTCAAGAAGG + Intergenic
1015532957 6:134239662-134239684 GGCCCCTGCATGTTGCTTGATGG + Intronic
1017892345 6:158649302-158649324 GAGCCATGGAAGATCCTTGATGG - Intergenic
1019799849 7:3080221-3080243 GGCCGTTGGCAGGTCCTTGATGG + Intergenic
1020044190 7:5028165-5028187 GCCCCATGGAACATCCTTGAGGG - Intronic
1021609588 7:22444494-22444516 GGTCCCTGGAATCCCCATGATGG - Intronic
1022763365 7:33381356-33381378 GTCTCCTGGGAGCTCCTTGAGGG + Intronic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1023843850 7:44110411-44110433 GCCCACTGGAATCTCCTTAATGG - Intronic
1024326003 7:48109682-48109704 GGACCCTGAAGTCTCCTTGAGGG - Intergenic
1024609740 7:51054390-51054412 GGCCTCTTCACGCTCCTTGAAGG + Intronic
1025144700 7:56493364-56493386 GAACCCTGGAAGCCCCTGGAGGG - Intergenic
1025221574 7:57114864-57114886 GGCCTTGGGAAGCTCCTTTATGG + Intergenic
1025267392 7:57474928-57474950 GGCCTTTGGAAGCTCCTTCATGG - Intergenic
1025585636 7:62782366-62782388 GGACCTTGGGAGCTCATTGACGG + Intergenic
1025632357 7:63286532-63286554 GGCCTTGGGAAGCTCCTTTATGG + Intergenic
1025650204 7:63459700-63459722 GGCCTTGGGAAGCTCCTTTATGG - Intergenic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1029458435 7:100682559-100682581 GGCACCTGGAGGCTCCGGGATGG - Intronic
1029903847 7:104071258-104071280 GGGCCATGGAAGGACCTTGAGGG - Intergenic
1031972335 7:128073866-128073888 GGCCCGTGGAGATTCCTTGAGGG + Intronic
1035524688 8:303449-303471 GTCCTCTGTAAGCTCCTAGAAGG - Intergenic
1036276295 8:7354846-7354868 GGCCTCTGGGCGCTCCTTGGTGG + Intergenic
1036345050 8:7955501-7955523 GGCCTCTGGGCGCTCCTTGGTGG - Intergenic
1036707199 8:11054809-11054831 GGGCCCTGGGAGCTCCTGGGAGG + Intronic
1036840386 8:12116268-12116290 GGCCTCTGGGCGCTCCTTGGTGG - Intergenic
1036862176 8:12362505-12362527 GGCCTCTGGGCGCTCCTTGGTGG - Intergenic
1042146860 8:65738754-65738776 GACCCCTAGAATCTCTTTGACGG - Intronic
1042290320 8:67164116-67164138 GGCCCAAGGAAGTTCCTTTACGG - Intronic
1047254598 8:123206222-123206244 GGCCCCAGGCCTCTCCTTGAGGG + Intronic
1048707521 8:137170439-137170461 TGCCCCTGCAGGCTGCTTGATGG - Intergenic
1049179769 8:141216228-141216250 GGCCCCTGGGAGCTGCAGGAAGG - Intronic
1049697399 8:143990768-143990790 GGCCCCTTAAAGCTGCTTAAGGG + Intronic
1051749520 9:20326673-20326695 GGCCCCTGTGAGCTCTCTGATGG + Intergenic
1053045971 9:34917624-34917646 GGCCCCGGGAAGCCACTGGAAGG - Intergenic
1053534217 9:38910126-38910148 AATCCCTGTAAGCTCCTTGAGGG - Intergenic
1053689574 9:40577086-40577108 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1054206441 9:62134545-62134567 AATCCCTGTAAGCTCCTTGAGGG - Intergenic
1054274456 9:63053971-63053993 GGCGACTGGAAGTTCCTGGAAGG + Intergenic
1054300820 9:63378025-63378047 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1054400368 9:64710958-64710980 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1054433959 9:65195216-65195238 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1054496428 9:65826454-65826476 GGCGACTGGAAGTTCCTGGAAGG + Intergenic
1054631917 9:67453801-67453823 AATCCCTGTAAGCTCCTTGAGGG + Intergenic
1056604686 9:88076791-88076813 GGGCCCTGGAAGCTCCAGGCGGG - Intergenic
1056823450 9:89860521-89860543 GACCCCTGGAAGCTCCAGGCTGG - Intergenic
1057072811 9:92115056-92115078 GTCCCCTGGAAGCTCCGGAAAGG - Intronic
1057286947 9:93764417-93764439 GGTCCCTGGAAGCTGCCAGAAGG - Intergenic
1059116543 9:111604791-111604813 GGCCAATGGAAGCTCCTTTAAGG - Intergenic
1059328745 9:113521225-113521247 AGCCCCTGAGAGCTCCTTCAAGG + Intronic
1061039506 9:128131762-128131784 GGTCCCTGGAAGCTCCAGGCTGG + Intergenic
1061058928 9:128240800-128240822 GGCCCCTGAGAGCTCCATGCAGG + Intronic
1061809613 9:133154780-133154802 GGCCCCAGGAAGTTCCAGGAAGG + Intronic
1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG + Intronic
1185779986 X:2835801-2835823 AGCCCCAGGAAGCTCATTCATGG + Intronic
1191738380 X:64411062-64411084 GGACCCTGGATTCTACTTGAGGG - Intergenic
1191778528 X:64843977-64843999 AGCCCCTGCAACCTCCTGGAGGG - Intergenic
1192190336 X:68987536-68987558 CTCACCTGGAAGCTCCTTGAGGG + Intergenic
1193731140 X:85105326-85105348 AGACACTGTAAGCTCCTTGAGGG + Intronic
1196611773 X:117723285-117723307 GACAGCAGGAAGCTCCTTGAGGG - Intergenic
1198339301 X:135698700-135698722 GGCCCCTGAGAGCCCCTTTATGG - Intergenic
1198533514 X:137566549-137566571 AGCCCCTGGTAGCGCCTTGGGGG + Exonic
1200072556 X:153536354-153536376 GGCCCCTCGCAGCTCCATGAGGG - Exonic
1201290063 Y:12414188-12414210 AGCCCCAGGAAGCTCATTCATGG - Intergenic