ID: 916417259

View in Genome Browser
Species Human (GRCh38)
Location 1:164603494-164603516
Sequence GGATCTGTATTTTCACATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916417259 Original CRISPR GGATCTGTATTTTCACATAA TGG (reversed) Intronic
901074650 1:6546128-6546150 GGAGTTGTTTTTTCACATAAGGG - Intronic
902633723 1:17721024-17721046 CGATCTGAATTATCACTTAATGG - Intergenic
909785650 1:79608905-79608927 GTATCTGTATTTCCTAATAAGGG - Intergenic
911987172 1:104641970-104641992 GAGTCTGTATCTTCACAAAAAGG - Intergenic
915510137 1:156382463-156382485 GGATCTATTTTTGCACATCAAGG + Intronic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
916423123 1:164654912-164654934 TGATCTGTATTATCACAGAGGGG + Intronic
916545066 1:165796311-165796333 GAATCTGAATTAACACATAAGGG + Intronic
916780317 1:168019671-168019693 GGAACTGTTTTTTCACTTTATGG + Intronic
918980234 1:191547982-191548004 GGGAATGTATTTTCAAATAAAGG - Intergenic
924720604 1:246619684-246619706 GGATCTGTAATTGCTCAGAAAGG + Intronic
1063533966 10:6864399-6864421 GGGGCTGAGTTTTCACATAAGGG - Intergenic
1064065887 10:12181285-12181307 GTATCTGCATTTTCATATCAGGG + Intronic
1067073669 10:43158574-43158596 GGATAAGTATTTTCACAAATAGG + Intronic
1068825052 10:61427543-61427565 AGATCTGTGTTTTCCAATAAAGG - Intronic
1068835418 10:61547281-61547303 AGACCTATATTTTGACATAATGG - Intergenic
1070431461 10:76343604-76343626 GGATGTGTTTTTTCATATTAAGG - Intronic
1070531214 10:77339042-77339064 GTATCTGTGTTTATACATAAAGG - Intronic
1071978575 10:90979879-90979901 ACATCTATATTTGCACATAAGGG - Intergenic
1072861685 10:99012717-99012739 TGATTTGTATTTTGACTTAACGG + Intronic
1074489873 10:113930047-113930069 GGATTTGTATCTCAACATAAAGG - Intergenic
1078455737 11:11473413-11473435 GAATCTGCATTTCAACATAAAGG + Intronic
1079142570 11:17822262-17822284 GGATATGTATTTGGAAATAATGG - Intronic
1080115183 11:28614227-28614249 GGACCTGAACTCTCACATAAGGG + Intergenic
1080298920 11:30762397-30762419 GGTTCTGTTTTTTGACATACCGG + Intergenic
1081391539 11:42535384-42535406 TGATCTGTAATTAGACATAATGG - Intergenic
1082581549 11:54875934-54875956 TGATGTGTATTTTCACCTCATGG - Intergenic
1086604070 11:88673853-88673875 GTATCTGTAATTTCAGATCAGGG + Intronic
1087578951 11:100026558-100026580 TGTTCTGAATTTTGACATAAAGG + Intronic
1087929913 11:103965283-103965305 GGATCTTTCCTTTTACATAATGG + Intronic
1087964495 11:104395741-104395763 GGAATTGTCTTATCACATAAAGG + Intergenic
1088833469 11:113557627-113557649 AGATGTGTATTTTACCATAAAGG - Intergenic
1093230241 12:16534991-16535013 GGATCTGGATTTTCAAAGTAAGG - Intronic
1094130031 12:27064624-27064646 GGACTTGTATTTTACCATAAAGG + Intronic
1094179490 12:27576620-27576642 GGACTTGTATTTTACCATAAAGG + Intronic
1096777988 12:53975209-53975231 GGATCTGGAATTTCGAATAAGGG - Exonic
1097386553 12:58956725-58956747 TGATTTATATTTTCACTTAAGGG - Intergenic
1097636870 12:62133551-62133573 GGAACTGTTTGCTCACATAATGG - Intronic
1097740742 12:63240058-63240080 TGTTCTGGATTGTCACATAATGG - Intergenic
1097830130 12:64215680-64215702 GGAGCTGTATTTTTTCATGATGG + Exonic
1098647876 12:72927723-72927745 GGATCTCTAATTTCTTATAAAGG - Intergenic
1099185972 12:79515753-79515775 TAATCTGTCTTTTCACTTAATGG + Intergenic
1102880254 12:116479693-116479715 GGAACTGTGTTTTCACATCAGGG - Intergenic
1107706631 13:43114059-43114081 GCATCCGTATTTTCACATATTGG - Exonic
1110221155 13:73075559-73075581 TGATATGTATTTACTCATAATGG + Intronic
1110459237 13:75726794-75726816 GGGTCTGTGTCTCCACATAAAGG + Intronic
1110896773 13:80762684-80762706 GGATCTATGTTTTCATATAATGG + Intergenic
1111342502 13:86905619-86905641 AGATAAGTATTTTCACATAAAGG - Intergenic
1112382131 13:98901704-98901726 GGATTTATAGTATCACATAAAGG + Intronic
1116006393 14:39296475-39296497 TGATCTGTAATTTCAGAGAAGGG - Intronic
1116088437 14:40272179-40272201 GGAGCTGCACTTTGACATAATGG - Intergenic
1116655816 14:47652497-47652519 AAATCAGTATTTTCAGATAAAGG - Intronic
1117804720 14:59480010-59480032 GAATCTGTATTTCCAAAGAAAGG + Intronic
1120802610 14:88709034-88709056 TAATGTGTATTTTCACACAAGGG + Intronic
1123794218 15:23755397-23755419 GGATCCTCATTTTCACATGAAGG - Intergenic
1125599074 15:40905944-40905966 GCCTCTGTCTTTGCACATAATGG + Intergenic
1126025208 15:44439634-44439656 GGTTTTGTATTTTCAAATTAGGG + Intronic
1126149661 15:45512175-45512197 GTGTCTGTATTGTCCCATAATGG + Intronic
1126731426 15:51687114-51687136 GGATTTGTATTTTGAAACAAAGG - Intronic
1126967526 15:54072301-54072323 AAATCTGTATTTTCACACCATGG + Intronic
1127413940 15:58738265-58738287 GAATATGTATTATCAAATAAAGG - Intronic
1127778102 15:62284671-62284693 CAGTCTGTATTTTCACAAAAAGG + Intergenic
1129031942 15:72625311-72625333 GAATCTATATTTCCAAATAAAGG - Intergenic
1131337860 15:91567052-91567074 GAATCTGTGTTTTCACATCTGGG - Intergenic
1133202229 16:4210955-4210977 GAATCTGCATTTTAACAAAATGG + Intronic
1135094095 16:19548959-19548981 GGAAGTGTATCTGCACATAAGGG + Intronic
1135737460 16:24943603-24943625 GCATTTGTATTTTGACATGATGG - Intronic
1136036748 16:27546274-27546296 GGATCTGTATTTGGAGAAAAAGG - Intronic
1139064315 16:63292906-63292928 GGGTGTGTATTTCCACAGAATGG - Intergenic
1140154218 16:72405735-72405757 GCATCTGGCTTTTCACTTAAAGG + Intergenic
1140563524 16:76011857-76011879 TGATCTGTATTGTCACAAAAGGG + Intergenic
1143816596 17:9521071-9521093 GCATCTTTATATTCACAGAAAGG - Intronic
1144165291 17:12604515-12604537 GGAACTGTATTTACAGATAGGGG + Intergenic
1146233608 17:31136030-31136052 GGCCCTGTATTTTCAAAGAAAGG - Intronic
1148577876 17:48724147-48724169 AGATATTTATTTTTACATAAGGG - Intronic
1150194811 17:63286414-63286436 GGATCTGTAGTTTTAAATTATGG - Intronic
1153261197 18:3226030-3226052 CCATCAGTATTTTCACATAATGG + Intergenic
1155947448 18:31871754-31871776 GGTTTTGTATATTCACATAATGG - Intronic
1156007224 18:32456818-32456840 GAATGAGTATTTTCACATCACGG + Intronic
1156218936 18:35031685-35031707 TGTTCTGTGTTTTCACATCATGG + Intronic
1157053288 18:44195839-44195861 GGATCTGAATCGTCACATCATGG - Intergenic
1157409285 18:47450116-47450138 GGATGTGTGCATTCACATAAAGG - Intergenic
1158926523 18:62269395-62269417 GGATTTTTTTTTTCAGATAAAGG + Intronic
1159234432 18:65652351-65652373 GGAGATGTATTTTCACTTATTGG + Intergenic
1159566946 18:70061940-70061962 GAATTTTTACTTTCACATAACGG - Intronic
1159967829 18:74613618-74613640 TGTTCTGTATTTCCCCATAAGGG - Intronic
1167903142 19:52637293-52637315 GGATCTGTGGTTCCACATATTGG - Intronic
927319254 2:21723372-21723394 GGATCTGTGTTTTCTAATCATGG + Intergenic
927859627 2:26552566-26552588 GGAAGTGTATTTTCATGTAATGG - Intronic
930569214 2:53063629-53063651 GTATCAGTATTTTCACATGTAGG + Intergenic
930621807 2:53651838-53651860 CTTTCTGTATTTTCACATAGGGG - Intronic
930913195 2:56655936-56655958 TGATCTATACTTTCACACAATGG + Intergenic
931284828 2:60823299-60823321 TGATCTCTATTTTAACATTAAGG + Intergenic
932777267 2:74535752-74535774 GGATCTGTAGTGACACAGAATGG + Exonic
933813209 2:86045965-86045987 TGATCTGGATTTTCACATTTGGG + Intronic
937549446 2:123068914-123068936 GGTTTTGTATTTTCAAACAAAGG - Intergenic
939997904 2:148937367-148937389 GAACCTGGAGTTTCACATAAAGG + Exonic
941561370 2:167049474-167049496 AGATCTATATTTACAAATAATGG + Intronic
944158891 2:196638783-196638805 GAATATGTATTCTCACTTAAGGG - Intergenic
944938895 2:204601063-204601085 AGACCTGTATTTTAAAATAATGG + Intronic
1169421881 20:5467053-5467075 GAATCTGTACTTTCACAGGATGG - Intergenic
1169599494 20:7241217-7241239 GGATATGAATTTTCTCTTAATGG - Intergenic
1169786038 20:9360054-9360076 GGATTTTTATTTTCACCCAATGG - Intronic
1170362555 20:15562483-15562505 GCATCTATATTATCACAGAATGG - Intronic
1170548978 20:17459393-17459415 GTATCTGTATGTTCACCAAAAGG - Intronic
1172543852 20:35743745-35743767 GGATCTGAATTTTCAGAAAAAGG - Intergenic
1174514888 20:51083982-51084004 GGAGCTGTACTTTCACAGGATGG + Intergenic
1174677630 20:52373815-52373837 GAATCTGCATTTTAACATGATGG + Intergenic
1174821783 20:53732779-53732801 GGATCTGTGTCTTCTTATAAGGG + Intergenic
1175229792 20:57466460-57466482 CGATTTGAATTTTCATATAAAGG + Intergenic
1175338750 20:58214192-58214214 GGATCTGTACTAGCACAAAAAGG + Intergenic
1175431517 20:58907831-58907853 GTATCTGAACTTTAACATAAAGG - Intronic
1177328421 21:19624659-19624681 GTTTCTATATATTCACATAAAGG + Intergenic
1177479303 21:21666012-21666034 GCATATCTATATTCACATAAGGG + Intergenic
1179264866 21:39794425-39794447 GGAGCTGTCTTTTCACAGGATGG + Intronic
1180251870 21:46595462-46595484 GGATCTGTATTTTAAATTAGGGG + Intergenic
1181711145 22:24690815-24690837 TGATTTGTATTTTGACTTAATGG - Intergenic
949714485 3:6913482-6913504 TGGTAAGTATTTTCACATAACGG - Intronic
949908405 3:8878900-8878922 GAAACTGTATTTTCACTAAAAGG + Exonic
953165341 3:40459913-40459935 GGACGTGTATTAACACATAATGG + Intronic
954880928 3:53835684-53835706 GGAGCTGTATGATCAGATAAAGG - Intronic
954892928 3:53947852-53947874 GAATCTGTATTTGAACAAAAGGG - Intergenic
956100531 3:65763327-65763349 AGATCTATATTTCCATATAAGGG + Intronic
956753031 3:72359930-72359952 GGATGTGTGACTTCACATAATGG + Intergenic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
958782417 3:98558556-98558578 AGAAATGTATTTTGACATAAGGG - Intronic
958822202 3:98988492-98988514 GGATCTGGAATTTCAGATAAGGG + Intergenic
959384120 3:105680412-105680434 GGATCTGTATATTTGCATATGGG - Intronic
960246538 3:115405998-115406020 GGATGTGTAATTTTACTTAAAGG + Intergenic
962294478 3:134169373-134169395 AGAACTCTATTTTCAAATAAAGG + Intronic
963099979 3:141591850-141591872 CTACCTGTATTTTCACATACAGG + Intronic
966460227 3:180168467-180168489 GGACATGTGTTTGCACATAATGG + Intergenic
967379395 3:188840791-188840813 GCATATGTAATTTCACATGATGG - Intronic
968021142 3:195390661-195390683 GAATCTGTTTTTTCACAAGATGG + Intronic
969718362 4:8879275-8879297 GGATTTGTAATTTCAAACAATGG + Intergenic
970313133 4:14803648-14803670 GGACCTGTATATTTACATAGTGG + Intergenic
972762687 4:42122277-42122299 TCATCTGTATTTTAACACAAAGG - Intronic
973084044 4:46032228-46032250 GGCTCTGTATTTTCGGATACTGG - Intergenic
973301707 4:48592371-48592393 GGATCTGTATTTTCTTTTCAAGG - Intronic
975573403 4:75840028-75840050 GGTTCTGTACTCTTACATAAGGG + Intergenic
976123743 4:81810917-81810939 CCATCTTTATTTTCAGATAATGG - Intronic
977258974 4:94774892-94774914 TGATCTTTATTTTTTCATAATGG + Intronic
978525730 4:109663176-109663198 GGATGTGTATTTTCAAATCCCGG - Intronic
978625026 4:110675545-110675567 GGAACTGTATTTTCCCCTTAGGG - Intergenic
978889644 4:113808886-113808908 GGGTCTTTATTTCCACATGATGG + Intergenic
979000999 4:115219474-115219496 ACATCAGTATTTTCACACAATGG + Intergenic
980658765 4:135827951-135827973 GCATTTGAATTTTAACATAAAGG - Intergenic
981302537 4:143204845-143204867 AGATCTGAATTTCAACATAAAGG + Intronic
981614258 4:146630260-146630282 TGATCTGTATATGCATATAAAGG + Intergenic
981863532 4:149385547-149385569 GGATCTGTATTTTAGGAGAAAGG - Intergenic
982259073 4:153478225-153478247 GAATCTGCATTTTCAAAAAATGG - Intronic
982857369 4:160401094-160401116 TCAAATGTATTTTCACATAATGG - Intergenic
985038321 4:185863138-185863160 GGATTTGCATTTTTACATTAGGG + Intronic
985061085 4:186080096-186080118 GACTCTGCATTTTCACATACAGG + Intronic
988351240 5:30110001-30110023 TAATCAATATTTTCACATAACGG + Intergenic
988444044 5:31265086-31265108 GGATTTGTCTTTGCAAATAATGG + Intronic
989387405 5:40867335-40867357 GGGTCTGGATTCTCACAAAAAGG - Intergenic
990766475 5:59189362-59189384 GCCTCTGTATTTTCAAATCAGGG + Intronic
990779792 5:59347163-59347185 GAATTTTTCTTTTCACATAATGG - Intronic
991345285 5:65659354-65659376 GGATCTTTATTTTTATGTAATGG - Intronic
991679960 5:69129233-69129255 GGATTTGGATTTTCAGATTAGGG - Intronic
992217010 5:74536182-74536204 GGCTCTGTGAGTTCACATAATGG + Intergenic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
996126962 5:119737079-119737101 GGTTCTGTCTTTCCAAATAAAGG - Intergenic
1000863214 5:166481646-166481668 GGATATATATTTTCACTTTAAGG - Intergenic
1001182888 5:169537479-169537501 GGCTCTTTATTTTCCCATTAAGG - Intergenic
1006766926 6:36514510-36514532 AGATCAGTATTTTCACTTTACGG + Intronic
1010436802 6:75840748-75840770 GGTGCTGTATTTGCACTTAATGG + Intronic
1010800863 6:80174320-80174342 GGAGCTACATTTTTACATAATGG + Intronic
1010830897 6:80527750-80527772 AAATCTGTATTTACACATAAAGG - Intergenic
1011135720 6:84098122-84098144 AGATCTGTAGTTTCAGAGAAAGG - Intergenic
1012960624 6:105617877-105617899 GGCTCTGTGGTTTCACATCATGG + Intergenic
1014450245 6:121573432-121573454 GAATTTGTATTTTCACAAAGTGG + Intergenic
1016397105 6:143636309-143636331 TGAAATGTATTTTTACATAAGGG + Intronic
1016912892 6:149216366-149216388 AGAGCTTTATTTTCAAATAAAGG - Intergenic
1017307388 6:152934886-152934908 GGGTCTATATTTTCAAACAAGGG - Intergenic
1017795333 6:157839401-157839423 GCATATGTATTTTCATGTAATGG + Intronic
1021499538 7:21315934-21315956 GGCTGTGTATTTACACACAAAGG - Intergenic
1024259650 7:47564290-47564312 GAATCTGTCTTTTCTCTTAAGGG - Intronic
1028837912 7:95395634-95395656 GAATGTGTATTATCACTTAAAGG + Intronic
1030461141 7:109838827-109838849 GGTTCTTAATTTTCACATATAGG - Intergenic
1032810697 7:135413201-135413223 GGATCTGTATTAGCATATTAAGG + Intronic
1033297830 7:140157353-140157375 GCCTCAGTGTTTTCACATAATGG - Intronic
1038053292 8:23833522-23833544 GAATCTGTACTCTCTCATAAAGG - Intergenic
1038992397 8:32882569-32882591 GCATCTGTATTTTAAGTTAAGGG + Intergenic
1041282149 8:56221178-56221200 TGAGCTGTATTTTCACTTTATGG + Intergenic
1043211994 8:77531709-77531731 GAATTTTTATTTTCAAATAATGG + Intergenic
1045922757 8:107550853-107550875 GCATTTTTATTTTAACATAAGGG + Intergenic
1047532846 8:125693086-125693108 GGATCTGTATTTATAAACAAAGG + Intergenic
1047590911 8:126326057-126326079 AGATTTATATTTTCACATAGTGG + Intergenic
1048525330 8:135197214-135197236 GGATGTCTATTTTCAGATGAGGG - Intergenic
1048747552 8:137631778-137631800 GGATCTATAATTTCTCATCAAGG + Intergenic
1049278833 8:141733734-141733756 GGATCTCTGTTTTAACATAATGG + Intergenic
1050525222 9:6540809-6540831 AGATCTGTAATTTCAAATAAGGG - Intronic
1050628260 9:7531160-7531182 TGATCTGTATTTTACTATAATGG + Intergenic
1050652922 9:7792425-7792447 GGATCTTAATTATAACATAATGG - Intergenic
1051466849 9:17388290-17388312 AAATCTGAATTTTAACATAAAGG + Intronic
1051541804 9:18228377-18228399 GGATCTGTGTTCTCATACAAAGG + Intergenic
1051786425 9:20749230-20749252 GGAAGTATATTTTCACAGAAAGG + Intronic
1052186332 9:25600538-25600560 GGATGTGTGTTTTTAGATAAGGG - Intergenic
1052188907 9:25633308-25633330 GGATCTGTCATTTAACATAGAGG + Intergenic
1052512201 9:29435968-29435990 GGATCTGCATGTGTACATAATGG - Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055433679 9:76270807-76270829 GGATATGTAATTTTAAATAAAGG + Intronic
1056867037 9:90237021-90237043 TGATCTCTATTTTAACATTAAGG - Intergenic
1059000852 9:110347428-110347450 GAATCAGTATTTTCACTTACAGG + Intergenic
1059801302 9:117752188-117752210 TGATCTGTATCCTCACATCAAGG + Intergenic
1061110739 9:128568437-128568459 GGGACTGGATGTTCACATAAAGG + Intronic
1187471236 X:19571154-19571176 GGAGCTGTATTTTCTCTTAGTGG - Intronic
1190177645 X:48164813-48164835 GGCTCTGTTTTCTCACAAAAAGG - Intergenic
1192952393 X:76030689-76030711 TGATTTGTATTTTGACTTAATGG - Intergenic
1197190853 X:123646629-123646651 GTGTATGTATTTTCCCATAAAGG - Intronic
1198441704 X:136669610-136669632 GGATCTGTATTTTTATAAAGTGG - Intronic
1199579951 X:149351125-149351147 GGCTCTGTATATTCACCCAAGGG - Intergenic
1202095703 Y:21246524-21246546 GGATCTGGAGTTTCAGAAAAAGG - Intergenic