ID: 916418227

View in Genome Browser
Species Human (GRCh38)
Location 1:164612117-164612139
Sequence TAGTTCAAGAAGGTGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916418219_916418227 5 Left 916418219 1:164612089-164612111 CCATGGCACAGTATAATATATGG 0: 1
1: 0
2: 0
3: 3
4: 119
Right 916418227 1:164612117-164612139 TAGTTCAAGAAGGTGGAGGCGGG 0: 1
1: 0
2: 0
3: 23
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916418227 Original CRISPR TAGTTCAAGAAGGTGGAGGC GGG Intronic
900823808 1:4910464-4910486 TAGTACAGAAATGTGGAGGCAGG + Intergenic
900956854 1:5891582-5891604 CACTTCAAGAAGATGAAGGCAGG - Intronic
902080887 1:13820019-13820041 TAGTTCAGGAAGGTGTGTGCAGG + Intronic
902171959 1:14618931-14618953 TGGGTCAAGAAGGTGTAGGTGGG + Intronic
906399540 1:45494954-45494976 TACTTCAAGAAGGTAGGGGCGGG + Intronic
906513089 1:46422737-46422759 GAGTTCATGAAGGTGGAGTGGGG + Intergenic
906949488 1:50322954-50322976 GACTTGAAGAAGGTGAAGGCAGG - Intergenic
907358055 1:53892625-53892647 TACTTTAAGAAGTTGGGGGCTGG + Intronic
910204469 1:84734385-84734407 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
910363396 1:86437717-86437739 CTGTTCAAGAATATGGAGGCTGG + Intronic
910926064 1:92399353-92399375 TAATTAAAGAAAGTGGAAGCTGG + Exonic
911208782 1:95118106-95118128 TTGTTTCAGAAGGTGGCGGCGGG - Intronic
911290261 1:96048941-96048963 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
913152677 1:116060886-116060908 CAGCTCCAGAAGGTGGAGTCTGG + Intronic
913344163 1:117791481-117791503 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
915754667 1:158248461-158248483 TGGTTCAAGAAAGTGGATCCTGG + Intergenic
916418227 1:164612117-164612139 TAGTTCAAGAAGGTGGAGGCGGG + Intronic
917600277 1:176566733-176566755 AAGTGCAAAAAGGAGGAGGCAGG - Intronic
918673879 1:187257487-187257509 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
919943029 1:202301423-202301445 CAGTTCAGGGAGGTGGAGGGAGG - Intronic
921058597 1:211563683-211563705 TATTTTAAGAAGGAAGAGGCTGG + Intergenic
922865626 1:228859193-228859215 TGGAACAAGAAGGTGGAGGAAGG - Intergenic
1064185990 10:13162169-13162191 GTGTTCCAGAAGGTGGAAGCGGG + Intronic
1064904775 10:20333917-20333939 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1069194429 10:65531361-65531383 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1070699319 10:78588200-78588222 GTGTTCAAGAATGTGGAGCCTGG - Intergenic
1072190738 10:93074521-93074543 CAGCGCAAGAAGGTGGGGGCAGG + Exonic
1072914220 10:99527254-99527276 GAGTTCGAGAACGTAGAGGCAGG + Intergenic
1073600671 10:104843113-104843135 TACTTGAAGAAGGTGGGGCCTGG + Intronic
1077223615 11:1428089-1428111 AAGTGAAAGAAGATGGAGGCAGG + Intronic
1078767773 11:14316102-14316124 TAGTCCAAGATGGTGGAAGAAGG - Intronic
1079312846 11:19381614-19381636 TATTTGATGAAGGTGGTGGCAGG + Intronic
1079540424 11:21566245-21566267 TAAATCAAGAAGGTGGACGTAGG - Intronic
1080822302 11:35819117-35819139 TATTTAGAGAAGATGGAGGCAGG + Intergenic
1087022875 11:93620974-93620996 TACTTGAGGAAAGTGGAGGCAGG + Intergenic
1087438832 11:98157613-98157635 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1087548200 11:99611677-99611699 TAGTTGAAAAAGGTGGATGGAGG + Intronic
1088784532 11:113168953-113168975 TATTGCATGAACGTGGAGGCAGG + Intronic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1089605133 11:119637454-119637476 TAGTATCAGAAGGTGGACGCTGG + Intronic
1089647328 11:119888917-119888939 TAGCTCAAGGAGATGGAGGTGGG + Intergenic
1090765762 11:129874678-129874700 TAGGACAAGATGGTAGAGGCAGG - Intronic
1091501663 12:1023620-1023642 TATTTTAAGCTGGTGGAGGCAGG + Intronic
1092452338 12:8614564-8614586 TAATCGAAGAAGGGGGAGGCAGG - Intergenic
1093628757 12:21383458-21383480 TAAAGCAAGAACGTGGAGGCAGG - Intronic
1093820692 12:23614311-23614333 TATTTCAAAAAGGGGGAGGAGGG - Intronic
1095729198 12:45487689-45487711 TAGAACAAAAAGGTGGAGGAGGG - Intergenic
1096668538 12:53183391-53183413 AAGTCCCAGAAGGTGGAGGGAGG + Intronic
1097673307 12:62568130-62568152 TAGGTTAAAAAGGGGGAGGCAGG + Intronic
1097949700 12:65414014-65414036 TAGTTGAGGGAGGTGGAGGAGGG + Intronic
1099948931 12:89278356-89278378 GAGTTCCACAAGGTGGAGGTAGG - Intergenic
1100126977 12:91439046-91439068 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1100737525 12:97553525-97553547 TAGCTCTAGAAGGTGGTTGCAGG + Intergenic
1100957080 12:99920795-99920817 TAGAACAAGAAAGTGGAGGAAGG - Intronic
1101062458 12:100986367-100986389 TAGGACAAAAAAGTGGAGGCAGG - Intronic
1101122015 12:101591978-101592000 TAGAGCAAGAAGGAGGAGTCTGG + Intronic
1101246875 12:102891886-102891908 TGGTTGGAGCAGGTGGAGGCTGG - Intronic
1101556235 12:105812501-105812523 TTGTTCAAGGAGGCGCAGGCAGG + Intergenic
1102369812 12:112373118-112373140 TAGTTCAAGAATATGGACTCAGG + Intronic
1105045082 12:132996176-132996198 CAGTGCAAGAAGCTGCAGGCTGG - Intronic
1106122097 13:26868836-26868858 TAGGTCAAGAAGGAAGAGGATGG - Intergenic
1108117341 13:47143994-47144016 GAGTACAAGAAGGTGGAGCATGG + Intergenic
1108776700 13:53773788-53773810 TAGTTAAAAGAGGTGGAGTCGGG + Intergenic
1110210941 13:72972326-72972348 TACTTTAAGAAAATGGAGGCAGG - Intronic
1110560369 13:76905157-76905179 TAGTTTCAGAAGGTGGAAACTGG - Intergenic
1112672775 13:101660153-101660175 TAGTTTAATAAAGTTGAGGCCGG + Intronic
1114376959 14:22156921-22156943 TACTTTAAGAAGTTGGAGACCGG - Intergenic
1115006701 14:28494329-28494351 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1116521152 14:45848660-45848682 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1117442643 14:55774277-55774299 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1119206268 14:72796253-72796275 TAATTCCAGAAGGCGGAGGCAGG + Intronic
1119415457 14:74466594-74466616 TTGTTCATGAAGGGGGAGGCTGG - Intergenic
1120228758 14:81820151-81820173 TAGCTCATGAAGATGGAGGGTGG - Intergenic
1121655480 14:95592413-95592435 TGGTTCCAGAAGGGAGAGGCAGG - Intergenic
1122239139 14:100350426-100350448 TATTTAGCGAAGGTGGAGGCTGG + Intronic
1123986460 15:25650572-25650594 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1124951016 15:34320795-34320817 TAGTTCCAGAAGGCTGAGACAGG + Intronic
1125200183 15:37095994-37096016 TTGTTCAAGTAGCTGGAGGCGGG + Intronic
1125719790 15:41839747-41839769 TAGCCCGAGAAGGTGGAAGCAGG + Intronic
1126904773 15:53352593-53352615 TAGTTCAAAAAGGCAGAGGAAGG - Intergenic
1126924729 15:53571380-53571402 TAGTTTCAGGAGCTGGAGGCAGG - Intronic
1127006997 15:54581915-54581937 AGGCTCAAGAATGTGGAGGCTGG + Intronic
1129604728 15:77019312-77019334 CCTTTCAAGAAGTTGGAGGCCGG - Intronic
1129623441 15:77171013-77171035 TAGTTCAAGAACGTGTACCCAGG - Intronic
1130933527 15:88449602-88449624 TAAAGCAAGAAGGTGGAGGCAGG + Intergenic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1133237690 16:4395208-4395230 TGGTTCTAGCAGGTGGAGGTAGG - Intronic
1133659999 16:7907083-7907105 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1133695160 16:8256252-8256274 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1135529686 16:23242337-23242359 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1136178975 16:28538142-28538164 TGGTTACAGGAGGTGGAGGCCGG - Exonic
1139098502 16:63735053-63735075 TACTTTAAGAATGTGGAGGCTGG - Intergenic
1143375179 17:6463033-6463055 TAGCTCTACAAGGGGGAGGCTGG + Intronic
1144825206 17:18101896-18101918 GAGATTGAGAAGGTGGAGGCCGG - Intronic
1145852898 17:28120502-28120524 TAGTCCCAGAAGGCTGAGGCAGG + Intronic
1146139117 17:30349551-30349573 TAGAACAAAAAGGTGGAGGGAGG - Intergenic
1147702847 17:42406729-42406751 GAGTCAAAGAAGGTGGAGGTGGG - Intronic
1147789611 17:43005511-43005533 TAGTTCCAGCAGGTTGAGGCAGG - Intergenic
1150601223 17:66652827-66652849 TAGAGTAAGAGGGTGGAGGCAGG - Intronic
1152157261 17:78642539-78642561 CAGTTAAAGATGGTGGAGCCAGG + Intergenic
1153507598 18:5817664-5817686 TAGTTAAAGACGCTGGACGCTGG - Intergenic
1153567211 18:6430462-6430484 AAGATCAAGAGGGTGGAGGGAGG - Intergenic
1154093305 18:11385348-11385370 ATGTTCAAGAAGGTGTAGGAAGG + Intergenic
1155119668 18:22805454-22805476 TAGATCAAGAAGGTGGAAGAAGG - Intronic
1155194602 18:23461675-23461697 GATTTCAAGAAGGCTGAGGCAGG + Intronic
1155541414 18:26872419-26872441 TAGCTCTGGAAGCTGGAGGCAGG + Intergenic
1155742249 18:29302990-29303012 TACTTTCAGAGGGTGGAGGCTGG + Intergenic
1155913379 18:31531433-31531455 TGGTTGAAGAAGGTGGATTCTGG - Intronic
1156148252 18:34212871-34212893 TAGTCCAAGAAGGGGAAGTCAGG - Intronic
1157545430 18:48543181-48543203 CAGGTCATGAAGGAGGAGGCAGG + Intronic
1159007162 18:63023413-63023435 TGGTTCTAGAAGGAAGAGGCGGG - Intergenic
1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG + Intronic
1160868218 19:1265539-1265561 CAGCTCAGGAATGTGGAGGCTGG - Intronic
1164808441 19:31137334-31137356 TAGAACAAAAAGGTGGAGGACGG + Intergenic
1165191587 19:34068200-34068222 AAATTCCAGGAGGTGGAGGCAGG + Intergenic
1165548492 19:36562533-36562555 TAGTATTAGAAGGTGGAGCCTGG + Intronic
1165861314 19:38910999-38911021 GATTTCAAGAAGCAGGAGGCTGG - Exonic
1165962136 19:39543903-39543925 TAGTCCCAGGAGGTTGAGGCAGG + Intergenic
1166992287 19:46699782-46699804 TAGTTTAAAAATGTGTAGGCTGG + Intronic
925328118 2:3038535-3038557 GAGTTCAAGAAGGCAGAGACGGG - Intergenic
925932243 2:8717775-8717797 TAGGACAAAAAGGTGGAGGAAGG + Intergenic
925960214 2:9006854-9006876 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
926872739 2:17441156-17441178 AAGACCCAGAAGGTGGAGGCAGG + Intergenic
927023706 2:19043712-19043734 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
929166013 2:38882640-38882662 AAGTTCAAAAAGGTGTAAGCAGG - Exonic
931089395 2:58869280-58869302 TAGCTGAAGCAGGTGGAGCCAGG + Intergenic
931092559 2:58901442-58901464 TGGTGGAAGAAGGTGGAGGAAGG + Intergenic
932301190 2:70668012-70668034 TAGAACAAAAAGGTGGAGGAAGG + Intronic
932366240 2:71155241-71155263 CAGTTCATGAAGGTGCTGGCAGG + Intergenic
932673265 2:73756386-73756408 TAGATCAAAAAGGTGGATACTGG + Intergenic
933035625 2:77393753-77393775 TAAATAAAGGAGGTGGAGGCAGG + Intronic
934965747 2:98720344-98720366 TAGATCAAAAAGGTGGAGGAAGG + Intronic
937454143 2:122026755-122026777 TAGAGCAAGAAGGTGGAGGAAGG - Intergenic
937558830 2:123194761-123194783 CAGTTCAAGAAGGATGATGCTGG - Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938337393 2:130511782-130511804 TAGGTCAGGGCGGTGGAGGCTGG - Intergenic
938352445 2:130608953-130608975 TAGGTCAGGGCGGTGGAGGCTGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
939557859 2:143698538-143698560 TAGTTTGAGAAGATGGGGGCAGG + Intronic
939950692 2:148468957-148468979 GAGCACAAGAAGGTGGAGGAGGG - Exonic
940842050 2:158594963-158594985 TAGTTCAGTAAGGTGAAGACAGG - Intronic
941132061 2:161663618-161663640 TAGTTAATGGAGATGGAGGCTGG + Intronic
941835841 2:170019603-170019625 TAAGCCCAGAAGGTGGAGGCTGG + Intronic
942270173 2:174266498-174266520 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
943469402 2:188275189-188275211 TGGTTCAAAAAACTGGAGGCTGG + Intergenic
945326614 2:208489478-208489500 AAGTAAAAGAAGGTGAAGGCAGG + Intronic
1168755686 20:315849-315871 TAGTCCCAGAAGGCTGAGGCAGG - Intergenic
1168866739 20:1093001-1093023 TAGGGCAGGAAGGTGGAGGAAGG + Intergenic
1171148977 20:22810312-22810334 TGGTTCAAGAAGGGGCAGGAGGG + Intergenic
1171329164 20:24322295-24322317 TAGATGAGGAAGCTGGAGGCTGG - Intergenic
1175889075 20:62308167-62308189 CAGTTCCAGCAGGTAGAGGCCGG + Exonic
1176613315 21:9006750-9006772 AAGTTGAAGAAGGAGCAGGCAGG - Intergenic
1177071186 21:16510474-16510496 TAGTTGAAGATGGAGGTGGCAGG - Intergenic
1177644234 21:23881699-23881721 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1177661927 21:24095842-24095864 TAGGTCTAGAAGAAGGAGGCTGG - Intergenic
1178695616 21:34790980-34791002 TAGTTCCAGAGGGTTGAGGCAGG - Exonic
1180712362 22:17848015-17848037 TAGTTCAAGAAGATCGGGGCAGG - Intronic
1180784807 22:18540967-18540989 TTGCTCAGGCAGGTGGAGGCAGG - Intergenic
1180983957 22:19893203-19893225 TAGCTGATGGAGGTGGAGGCAGG + Intronic
1181018678 22:20086595-20086617 TAGATGAAGAAGGAGCAGGCGGG + Exonic
1181128389 22:20715022-20715044 TTGCTCAGGCAGGTGGAGGCAGG - Intronic
1181241711 22:21480324-21480346 TTGCTCAGGCAGGTGGAGGCAGG - Intergenic
1184407433 22:44308092-44308114 TGGTTACAGAAGGTGGAGCCAGG - Intronic
1184555917 22:45233040-45233062 CAGATCAGGAAGGTGGAGGAAGG + Intronic
949352197 3:3135433-3135455 TATGTCTAGATGGTGGAGGCTGG + Intronic
950755811 3:15171595-15171617 TGGTACAAGAAGGTGAAGGAAGG - Intergenic
951391146 3:22105691-22105713 TAGAACAAAAAGGTGGAGGAAGG - Intronic
952138113 3:30446533-30446555 TAGAGCAAGAATGTGGAGCCTGG - Intergenic
953115969 3:39992796-39992818 AAGGTCAAGAATTTGGAGGCTGG - Intronic
953227962 3:41037826-41037848 TAGATCCAGAAGGAGGAAGCAGG + Intergenic
953394544 3:42557018-42557040 TATTTCAAGAAGGTATCGGCCGG - Intronic
954580521 3:51700662-51700684 TGGGTCAAGGAGGGGGAGGCAGG - Intronic
955687677 3:61562560-61562582 TGGTCGAGGAAGGTGGAGGCAGG + Intronic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
957549962 3:81691512-81691534 TAGCCCAAGAAGGCCGAGGCAGG + Intronic
958744714 3:98118831-98118853 TGGATCAGGAAGGTGGAAGCTGG + Intergenic
959245982 3:103868602-103868624 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
962338253 3:134557897-134557919 AATTCCAAGAAGGTGGAGGAAGG - Intronic
963043701 3:141087411-141087433 AAATTGAAGAAGGTGGAGGGAGG + Intronic
963226329 3:142866232-142866254 TAGAACAAAAAGGTGGAGGAAGG + Intronic
963525987 3:146413994-146414016 AAGTCCAAGAAGGTGGAAGGTGG + Intronic
964508913 3:157427943-157427965 TAGAACAAAAAGGTGGAGGAAGG + Intronic
966888649 3:184390403-184390425 TAGACAAAGAAGGTAGAGGCTGG - Intronic
967734103 3:192934003-192934025 TGGTTAAAGAAGGTGGAGGAAGG - Intergenic
969236590 4:5869766-5869788 TAACTCAAGAACCTGGAGGCAGG + Intronic
970017334 4:11526607-11526629 TGGTTAGAGATGGTGGAGGCGGG - Intergenic
970955742 4:21809217-21809239 TAGGACAAAAAGGTGGAGGAAGG + Intronic
972123019 4:35729251-35729273 AGGTTCATGAAGGTGGGGGCAGG + Intergenic
972200663 4:36710736-36710758 TAGTAAAAGAAGATGTAGGCTGG + Intergenic
972349586 4:38224313-38224335 TACTTAATGGAGGTGGAGGCGGG + Intergenic
973895177 4:55405059-55405081 TATTCAAAGAAGGTGGAGGGAGG - Intronic
976324376 4:83754169-83754191 AAGTGGAAGAAGGTGTAGGCTGG + Intergenic
976428391 4:84933059-84933081 TAATTCAAAAAGGAGGAGCCTGG + Intronic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
980563606 4:134508706-134508728 AAGTTCAGGAAGCTGGAGGAAGG - Intergenic
980907596 4:138963311-138963333 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
981518598 4:145636646-145636668 ATGTTGAAGAAGGTTGAGGCAGG - Intronic
982100130 4:151959385-151959407 TGGCTCAAGAAAGTGGAGGGTGG - Intergenic
982686373 4:158494746-158494768 TATCTCAAGAAGATGCAGGCTGG + Intronic
986235529 5:5906174-5906196 GAGTCCAAGAAGGTGGTGGTGGG - Intergenic
986381695 5:7192989-7193011 TATTTCCAAAAGGTAGAGGCAGG + Intergenic
987220750 5:15788558-15788580 AGGTTCAAGGAGGTGGAGGCAGG - Intronic
988736953 5:34032199-34032221 TATTTCTGGAAGGTGGAGGAGGG - Intronic
990001862 5:50902731-50902753 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
990049341 5:51477463-51477485 TTCTTCAAGAAGGTGGTGGTGGG + Intergenic
991272053 5:64795887-64795909 TAGTTCTAGAAGGTAGAAGTAGG + Intronic
991449504 5:66737160-66737182 TAATTCAGGAAGGTGCAGCCAGG + Intronic
992673992 5:79087076-79087098 TAGTTCTAGAAGATGGAAGGGGG - Intronic
1000206494 5:159065242-159065264 TGCTTCAGGAAGGTGGAGGAGGG + Intronic
1000358976 5:160430237-160430259 TAGTTTCAGGAGGTTGAGGCAGG + Intergenic
1000833903 5:166133017-166133039 TTTTTGAGGAAGGTGGAGGCAGG + Intergenic
1001476700 5:172055577-172055599 AAGATCAAGCAGGTGGGGGCCGG - Exonic
1002345457 5:178545169-178545191 TAGTTCCTGATGGGGGAGGCGGG + Intronic
1003473005 6:6454214-6454236 TAGAACAACAAGGTGGAGGAAGG + Intergenic
1005083585 6:21981319-21981341 CAGCTCAGGAAGGAGGAGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1006234427 6:32616140-32616162 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1008709382 6:54205582-54205604 TAGTTCAAAAAGGTGCAGCTGGG + Intronic
1008946701 6:57105592-57105614 TAGTTAAATAAGGGGGAGGGAGG - Intronic
1010815055 6:80348402-80348424 TGTTTCTAGAAGTTGGAGGCCGG - Intergenic
1011094072 6:83638196-83638218 TAGTTGAAGAGGGAGGAAGCCGG - Intronic
1011483486 6:87818454-87818476 TGATACAAGAAGGTGGAGGAGGG - Intergenic
1013634446 6:112015995-112016017 AAGTTCAAGGAGGTGTAGGAAGG + Intergenic
1014103617 6:117538936-117538958 TATTTCAAGAACTTGGAGGTAGG - Intronic
1014399299 6:120967212-120967234 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1015199117 6:130559339-130559361 TAGTCCAAGAATGTGTAGGCTGG + Intergenic
1017038641 6:150289691-150289713 TTCTTCATGAAGGTGAAGGCTGG + Intergenic
1020103577 7:5409468-5409490 TAGTCCGAGAAGGCTGAGGCAGG + Intronic
1022170985 7:27830939-27830961 TAGTGCAAGAAACTGCAGGCTGG - Exonic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023907753 7:44534245-44534267 TAATTCCAGATGGTAGAGGCAGG + Intronic
1024466889 7:49720812-49720834 TGGATCAAGATGATGGAGGCAGG + Intergenic
1024619643 7:51146638-51146660 TAGTGCAGGAATGTGGGGGCGGG + Intronic
1025144372 7:56491942-56491964 GAGTTGAAGAGGTTGGAGGCTGG + Intergenic
1025259977 7:57412421-57412443 GAGTTGAAGAGGTTGGAGGCTGG + Intergenic
1026219397 7:68379815-68379837 TAGTTCAAAGGGCTGGAGGCAGG + Intergenic
1027329263 7:77074206-77074228 AAGTTAAAGAACGTTGAGGCTGG - Intergenic
1027458950 7:78428231-78428253 TAGTAGAAGAAGGTGGGAGCAGG + Intronic
1028392210 7:90329512-90329534 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1029710356 7:102295859-102295881 GAGTTCACGAAGGTGGGGGAAGG - Intronic
1029786501 7:102797164-102797186 AAGTTAAAGAACGTTGAGGCTGG + Intronic
1032339558 7:131058393-131058415 TAAATAAAGAGGGTGGAGGCTGG - Intergenic
1032491240 7:132326136-132326158 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1033858363 7:145593996-145594018 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1036792068 8:11727515-11727537 TGGTTAAAGAAGCTGGAGTCAGG + Intronic
1038157727 8:25006583-25006605 TAGTTGAAGAATTTGGAAGCAGG + Intergenic
1038381221 8:27096154-27096176 TAGAACAAGAAGGTGGAGAAAGG + Intergenic
1041278382 8:56187109-56187131 AGCTTCAAGAAGGAGGAGGCTGG - Intronic
1041639098 8:60177679-60177701 GACTACAAGAAGGGGGAGGCAGG - Intergenic
1042050895 8:64705216-64705238 TAATTCAAAAAGGTGGGGGGGGG + Intronic
1043269237 8:78308597-78308619 TATTTCAAGAAAATGGAGTCTGG + Intergenic
1044351945 8:91176738-91176760 TAGAACAAAAAGGTGGAGGGAGG - Intronic
1046929339 8:119826880-119826902 TATCTTAAGAAGGAGGAGGCTGG - Intronic
1047712230 8:127564101-127564123 TAGTTCAAAATGATGGAGACAGG + Intergenic
1049423167 8:142525746-142525768 AGGTTCCAGAAGCTGGAGGCTGG - Intronic
1049694134 8:143975438-143975460 TAGGTTAAGAAGGTGGTGGGTGG - Intronic
1052890154 9:33691628-33691650 TAGTTCTATCAGATGGAGGCTGG + Intergenic
1052897714 9:33763401-33763423 TTGCTAAAGAAGGTGGAGGCCGG + Intronic
1052990261 9:34514831-34514853 TAGGTCAGGAAGGAGAAGGCGGG + Intronic
1056149545 9:83771376-83771398 TAGTTCAAGAATGTGGGGACAGG - Intronic
1056313441 9:85366106-85366128 TAGTTTAACAGGGAGGAGGCTGG + Intergenic
1057415496 9:94858703-94858725 TAGGTCATGAGGGTGGAGGGTGG + Intronic
1059590804 9:115659360-115659382 TAATTCAAGAAGGTGGAAGATGG - Intergenic
1059756176 9:117295834-117295856 TACTTCCAGAAGGTGGTGGTAGG + Intronic
1060547699 9:124470621-124470643 TAGTCCCAGAAGGTTGGGGCTGG - Intronic
1061044370 9:128156853-128156875 TAGTTCAGGGAGGAGAAGGCAGG + Intergenic
1061279275 9:129587809-129587831 TACTTTAAGATGGTGGAGACCGG + Intergenic
1061544483 9:131296548-131296570 TACTACAAGAATGTGTAGGCTGG - Intronic
1061659298 9:132118004-132118026 TAGTGCAAAAAGCTAGAGGCAGG - Intergenic
1062203229 9:135320108-135320130 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1203655445 Un_KI270752v1:19882-19904 CAATTCCAGCAGGTGGAGGCTGG + Intergenic
1185513033 X:677343-677365 TAGTGAAGGAACGTGGAGGCTGG + Intergenic
1185944186 X:4356122-4356144 TAGATCAAAAAGGTGGAGAAAGG + Intergenic
1187851234 X:23593374-23593396 TAGTTGAAGAGGGAGGAAGCTGG - Intergenic
1189073826 X:37894779-37894801 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1189885719 X:45542407-45542429 TAGTATTAGAAGGTGGGGGCTGG - Intergenic
1190942609 X:55056804-55056826 TATTTCAATAGGGTAGAGGCAGG + Intergenic
1195042046 X:101023548-101023570 TATTTCATGAAGGTGGATACTGG - Exonic
1195956463 X:110336203-110336225 TAGCTCAAAAAGGTTGAGACTGG - Intronic
1196082792 X:111650500-111650522 TGGTTCAACAAGGATGAGGCAGG - Intergenic