ID: 916421205

View in Genome Browser
Species Human (GRCh38)
Location 1:164639507-164639529
Sequence GGATGATTTGTTTGGAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916421200_916421205 16 Left 916421200 1:164639468-164639490 CCCATCTTATGGATGATGAGACA 0: 1
1: 0
2: 9
3: 59
4: 588
Right 916421205 1:164639507-164639529 GGATGATTTGTTTGGAACCCTGG 0: 1
1: 0
2: 0
3: 11
4: 113
916421201_916421205 15 Left 916421201 1:164639469-164639491 CCATCTTATGGATGATGAGACAG 0: 1
1: 0
2: 9
3: 53
4: 646
Right 916421205 1:164639507-164639529 GGATGATTTGTTTGGAACCCTGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916421205 Original CRISPR GGATGATTTGTTTGGAACCC TGG Intronic
903093573 1:20946493-20946515 GGTAGATTTGTCTGGAACCTTGG + Intronic
905662333 1:39737165-39737187 GGATGGGTTGATTGGAACCCAGG - Intronic
907326112 1:53639496-53639518 GGCTGTTTTGGTTGGAACCCTGG + Intronic
908542193 1:65132118-65132140 GAATAATCTCTTTGGAACCCTGG - Intergenic
910317689 1:85905551-85905573 GGAAGATTTGTTTAGAAACAAGG - Intronic
910368271 1:86489176-86489198 GGATGATTTGCTGAGACCCCCGG + Intronic
914214536 1:145613262-145613284 GGATGACTAGTTTGGAATACAGG - Intronic
914315469 1:146507481-146507503 GAATTATTTGTTTGGAAGGCAGG - Intergenic
914466477 1:147933652-147933674 GGATGACTAGTTTGGAATACAGG - Intronic
914498886 1:148225880-148225902 GAATTATTTGTTTGGAAGGCAGG + Intergenic
916079833 1:161225579-161225601 TGAAGACTTCTTTGGAACCCTGG - Intergenic
916298266 1:163244625-163244647 GGGTAATTTGTTTGCAACTCTGG + Intronic
916421205 1:164639507-164639529 GGATGATTTGTTTGGAACCCTGG + Intronic
919360344 1:196584870-196584892 AAATGTTTTGTTTGGAACCCTGG - Intronic
1065798601 10:29330587-29330609 GGAAGACTTGTTTAGAACACTGG + Intergenic
1065992250 10:31023456-31023478 GGACAATATATTTGGAACCCAGG - Intronic
1067130154 10:43556819-43556841 GGATGAGGAGTTTGGAACTCTGG + Exonic
1069083817 10:64116448-64116470 TGATGACTTGTTTGGATTCCAGG + Intergenic
1074771872 10:116740169-116740191 GGAAGTGTTGTTTGGGACCCAGG - Intronic
1075542841 10:123329909-123329931 GTCTGTTTTGTTTGAAACCCAGG + Intergenic
1076117778 10:127912625-127912647 GGAAAACTTGTTTGGATCCCAGG + Intronic
1078058584 11:8029182-8029204 GCATGCTTTGTTTGGGAACCCGG - Intronic
1078913607 11:15757075-15757097 TAATGCTTTGTTTGAAACCCTGG - Intergenic
1080280385 11:30550255-30550277 CAATGATTTCTTTGGAACCAGGG - Intronic
1082934317 11:58640496-58640518 GGATGTTTTGTTTTCAGCCCTGG + Intronic
1084589277 11:70080714-70080736 GGAAGTGTTGTGTGGAACCCAGG - Intronic
1086578725 11:88371447-88371469 GGAAGATTAGTTTAGAAACCTGG + Intergenic
1087006818 11:93479503-93479525 GTATTATTTGTCTGGTACCCAGG - Intronic
1090935287 11:131336155-131336177 AAATGGTTTGTTTTGAACCCTGG + Intergenic
1099061136 12:77910698-77910720 GGCTGACTTGTTTGGATGCCTGG - Intronic
1099515386 12:83590576-83590598 TGATGCTTTGTTTAGAACCATGG + Intergenic
1099728072 12:86460250-86460272 GGATGAAGTATTTGGAGCCCAGG - Intronic
1105151123 13:17271351-17271373 GGAGGATTTCTTTGGAAACCGGG + Intergenic
1105330269 13:19409566-19409588 GTATGTTTTGTTTGGAGCCTTGG - Intergenic
1106405623 13:29470524-29470546 GGAGAATGTGTTTGGAGCCCAGG - Intronic
1106769153 13:32944974-32944996 GGATGATTTAGCTGGAATCCAGG + Intergenic
1108066135 13:46579136-46579158 GAATGCTTCTTTTGGAACCCTGG + Intronic
1108757875 13:53525982-53526004 AGATGGTTTGTCTGGAAGCCTGG + Intergenic
1108995115 13:56721239-56721261 TGATGATTTTCTTGGATCCCAGG - Intergenic
1112678817 13:101738314-101738336 AGATGATTTATTTGGTGCCCTGG - Intronic
1112980098 13:105373055-105373077 GGGTGGTTTGTTAGGAACACAGG + Intergenic
1113800193 13:113082495-113082517 GGATGTTTTGTTTGGAAACATGG + Exonic
1114156781 14:20112519-20112541 TGATGATAGGTTTGGAAACCAGG + Intergenic
1117440711 14:55756604-55756626 AGATGATTTGATTGGAACAAGGG + Intergenic
1118674511 14:68169196-68169218 GGATGATTCATTTGCTACCCTGG + Intronic
1119378021 14:74210552-74210574 GTCTGATTTGCTTGGAACTCAGG + Intergenic
1125558764 15:40609664-40609686 GGATCATGTGTTTGTATCCCAGG + Intronic
1126180473 15:45780530-45780552 GGAAGATGTGCTTGGAACCAGGG + Intergenic
1128522723 15:68386305-68386327 GGATGATTTGCTTCTAAGCCAGG + Intronic
1136191597 16:28618698-28618720 CGCTGATTTGTTTTGAACCTTGG + Intronic
1140971173 16:80014135-80014157 GGATGATTTGGTAGGGACTCGGG + Intergenic
1143529705 17:7495670-7495692 AGGTGATTTGTATGGAACCCAGG + Intronic
1143758992 17:9087734-9087756 TCATCCTTTGTTTGGAACCCTGG + Intronic
1144079285 17:11747864-11747886 GACTGATCTGTTTGGAACCGCGG + Intronic
1146163070 17:30570317-30570339 GGAAGATCTGTTCAGAACCCTGG - Intergenic
1147378269 17:40035900-40035922 GGATGCTGAGTCTGGAACCCAGG - Intronic
1149732504 17:58960209-58960231 GTATGACTTGCTAGGAACCCAGG + Intronic
1150419950 17:65024656-65024678 GGTGGATTTGTTTGGAGACCTGG - Intronic
1151255690 17:72874644-72874666 TGATGATTTCTTTGGAAGCAAGG - Intronic
1152007657 17:77692671-77692693 GGATGTGTTGTTTGGGCCCCAGG + Intergenic
1152260342 17:79263383-79263405 ATGTGATTTGTTTGGAACGCTGG + Intronic
1157677701 18:49579361-49579383 GGATCATTTGTTTCCAACCTGGG - Intronic
1163798337 19:19349804-19349826 GGATGATATGTTTGGAAGTCCGG - Intronic
929526946 2:42713124-42713146 GGATGATTTGCCTGGCACCTTGG + Intronic
931982331 2:67707216-67707238 GGAAGATTTGTCTGGAATCCTGG + Intergenic
935194548 2:100804692-100804714 GGATGCTGTGCTTGGAGCCCAGG + Intergenic
939948551 2:148440664-148440686 TGACAATTTGTTTGGAAACCAGG + Intronic
942433862 2:175948870-175948892 GAAAGATTTGGTTGGAATCCTGG + Intronic
947076523 2:226351152-226351174 GGAAAATGTGTATGGAACCCAGG - Intergenic
1169674655 20:8140116-8140138 TGGTGTTTTGTTTGGACCCCGGG + Intronic
1170953648 20:20958534-20958556 GGATGATTAGATTGGATCCTTGG - Intergenic
1177199844 21:17942172-17942194 AGATAATTTGTTTGGAAACATGG + Intronic
1180564621 22:16652261-16652283 GTATGTTTTGTTTGGAGCCTTGG + Intergenic
952581342 3:34837138-34837160 GAAGGATTTGTTGAGAACCCTGG - Intergenic
952597913 3:35041843-35041865 GAAAGATTTTTTTGGAGCCCAGG - Intergenic
955392903 3:58534245-58534267 GGAAGACTTGTTGGGAAACCAGG - Intronic
956670687 3:71686692-71686714 GGATTTATTGTTTGGAAACCAGG - Intronic
956917673 3:73890109-73890131 CAATGATTGGTTTGGAATCCAGG + Intergenic
963722017 3:148872640-148872662 GAATGATTTGATTGAAACACTGG - Intronic
963731650 3:148980548-148980570 GGAAGATTTTTTTTGAGCCCAGG - Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969919905 4:10527967-10527989 GGATTGATTGTTTGGAAGCCTGG - Intronic
969925435 4:10581133-10581155 GGATGTTTTGTTTGTAACCTAGG + Intronic
973035392 4:45399275-45399297 AGATGATTTGATTGGAACCATGG + Intergenic
975089812 4:70388730-70388752 AGAAGATCTGTTTGTAACCCTGG + Intronic
975300784 4:72788621-72788643 GGATGACTTTTTTGGAATACTGG - Intergenic
976027684 4:80710659-80710681 GGATGATGTAGTTGGAACGCTGG - Intronic
976199308 4:82562702-82562724 AGAGGTTGTGTTTGGAACCCAGG - Intergenic
977726640 4:100303889-100303911 TGATTATTTGTTTGGAATACTGG - Intergenic
980028506 4:127795924-127795946 TGAAGATATGTTTGTAACCCTGG - Intronic
980402265 4:132306584-132306606 GGAGTATATGTATGGAACCCAGG - Intergenic
983794279 4:171840735-171840757 GGATGCTTGGCTTGGAGCCCTGG - Intronic
985046639 4:185947499-185947521 GGAAGGTTGGGTTGGAACCCAGG - Intronic
985585149 5:727860-727882 GGATGATTTTTGTATAACCCTGG + Intronic
986488716 5:8267399-8267421 TGATGATGAGTTTGGTACCCTGG + Intergenic
988615361 5:32769832-32769854 TGCTGACTTGTTTGGAACACAGG + Intronic
988976120 5:36517247-36517269 AGATGGTTTGTTTGGGAGCCAGG - Intergenic
990985562 5:61638226-61638248 GGATGATGTGTTTGGAAAATGGG + Intronic
995184337 5:109255922-109255944 GGATGATTTATGTGGAGTCCAGG - Intergenic
999930198 5:156423961-156423983 AGTTGATTTTTTTGGATCCCAGG + Intronic
1005266779 6:24120528-24120550 GGATGTGTAGTTTGGCACCCTGG - Intergenic
1020891227 7:13880280-13880302 GGATGACTTGTTTGGGATCTAGG - Intergenic
1020961687 7:14812627-14812649 GGATAATTTATCTGGGACCCTGG - Intronic
1022813813 7:33894823-33894845 GGCTGCCTGGTTTGGAACCCTGG + Intergenic
1025231118 7:57203831-57203853 GGATGATTGCTTTGGACCCAGGG - Intergenic
1026717880 7:72805771-72805793 GGATGATCTGTCTAGCACCCTGG - Intronic
1028756357 7:94439475-94439497 AGATGATTTCTTTGGAACTTTGG - Intergenic
1032551612 7:132789676-132789698 TGATGATTGGTTAGCAACCCAGG - Intronic
1035392513 7:158514654-158514676 GGATGATGTGTTTGGAAAGTAGG - Intronic
1037736967 8:21575521-21575543 GAATGAATTGTTTTGAAGCCGGG + Intergenic
1039296043 8:36156124-36156146 GAATGATTGGGTTGGAACCTGGG + Intergenic
1047431789 8:124799160-124799182 TGAAGATTTGTTTGGGACTCAGG - Intergenic
1048274083 8:133052804-133052826 GTATGATTTGTTTGGCTTCCTGG + Intronic
1048385506 8:133908993-133909015 GGATGAGTGCTTAGGAACCCAGG + Intergenic
1050043824 9:1523074-1523096 GGATGATATTTCTGGAACCCAGG + Intergenic
1050946889 9:11533904-11533926 GAATGATTTGTTTGGATAACTGG + Intergenic
1051757136 9:20414159-20414181 GGAAGATTTGTTGTGATCCCTGG + Exonic
1052603978 9:30673899-30673921 GGATCATTTGCATGGATCCCTGG + Intergenic
1058350785 9:104019789-104019811 GGAAGATTTGTTTGATACCTAGG + Intergenic
1059465061 9:114463743-114463765 TGATGCTTTGTTTGGACTCCAGG - Intronic
1186467820 X:9797711-9797733 GGATGATTTCCTGGGAGCCCTGG + Intronic
1186944416 X:14549471-14549493 GGATGATTGTCCTGGAACCCTGG - Intronic
1198989534 X:142495637-142495659 GGGTGATTTGATTTTAACCCTGG + Intergenic
1199520590 X:148730924-148730946 GGATGAGGTGTTTGGCAGCCAGG + Intronic
1202601037 Y:26593241-26593263 GTATGTTTTGTTTGGAGCCTTGG + Intergenic