ID: 916425788

View in Genome Browser
Species Human (GRCh38)
Location 1:164678344-164678366
Sequence GAGGATTATGCCTTCTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916425788 Original CRISPR GAGGATTATGCCTTCTATGC TGG (reversed) Intronic
904562856 1:31410436-31410458 GTGAGTTATGCCTTCCATGCTGG + Intronic
905349556 1:37335825-37335847 TACTATTATACCTTCTATGCTGG - Intergenic
906202928 1:43971539-43971561 GAGTATGGTGCCTTCTATGTAGG + Exonic
909045075 1:70700000-70700022 GAGGACAATGCCTTGTATGTGGG - Intergenic
910095335 1:83515208-83515230 GAGGATTAGGGCTTCAATGGTGG + Intergenic
910992014 1:93066484-93066506 GAGGATTAAGCCTTCCAGGGAGG + Intergenic
911829490 1:102532897-102532919 GAGGATAAGGACTTCTATACAGG - Intergenic
914260423 1:145994579-145994601 GAAGATCAGGCCTTCTATCCTGG - Exonic
916425788 1:164678344-164678366 GAGGATTATGCCTTCTATGCTGG - Intronic
924592919 1:245420690-245420712 GAGGATGATACCTGCTCTGCAGG + Intronic
924795734 1:247291010-247291032 GATGATTGTGCCTCCTTTGCAGG + Intergenic
1075204725 10:120437091-120437113 GAGGATGCTGCATGCTATGCAGG + Intergenic
1080602683 11:33835248-33835270 GAAGATTCTGCCTTCTGTCCTGG + Intergenic
1084721708 11:70910194-70910216 GAGGATTAGGGCTTCAATGCAGG + Intronic
1088906877 11:114161913-114161935 GAGGCCTGTGCCTTCTGTGCTGG + Intronic
1090249692 11:125242583-125242605 GAGGAGTCTGCATTCCATGCTGG + Intronic
1093678895 12:21977195-21977217 GAGGGTTCTGACTTCTATTCAGG + Intergenic
1093678958 12:21978017-21978039 GAGGGTTCTGACTTCTATTCAGG + Intergenic
1095515521 12:43000885-43000907 GAGGATAATGCTTACTTTGCAGG - Intergenic
1095658789 12:44703725-44703747 GAGGATAATGCCTACTGTGAAGG - Exonic
1102736697 12:115167915-115167937 GATGATTATGTGTTTTATGCTGG + Intergenic
1108512043 13:51165122-51165144 GAGATTTCTGCCTTCTATTCGGG + Intergenic
1110425742 13:75364231-75364253 GAGGAATGTGCCTTGTATGTTGG - Intronic
1110452674 13:75654598-75654620 GAGGAAAATGTATTCTATGCTGG - Intronic
1112718875 13:102218994-102219016 GATTATTATGCATTGTATGCCGG - Intronic
1117833813 14:59780985-59781007 GATAAACATGCCTTCTATGCAGG - Intronic
1118552009 14:66962918-66962940 TAGGATTATACCTATTATGCTGG - Intronic
1120776395 14:88442443-88442465 AAGGAACATACCTTCTATGCTGG - Intronic
1128693452 15:69742980-69743002 AAGGTTTATTCCTTCCATGCAGG + Intergenic
1132677805 16:1127817-1127839 GAGGGTCATGCCTGCTGTGCAGG - Intergenic
1142672670 17:1494370-1494392 GTGGAGCATGCCATCTATGCCGG - Intergenic
1146682451 17:34817845-34817867 GGGGAAAATGCCTTCTAAGCTGG + Intergenic
1150925360 17:69526821-69526843 GTGGAGTATGCCCTCTCTGCTGG + Intronic
1156064434 18:33122460-33122482 CAGCATTATGCCTGCTATGAAGG - Intronic
1159165415 18:64692820-64692842 AAGGATTATGCTTTCTAAACTGG - Intergenic
926913052 2:17869320-17869342 GAGGATGCTGCCTGCTATGCAGG + Intergenic
928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG + Intronic
928670094 2:33594272-33594294 GAGGATGATGGCTTGCATGCTGG - Intronic
929536473 2:42787335-42787357 GAGGCTTCTGCCTTCTCTGTTGG - Intronic
931831632 2:66058533-66058555 GAGGGATGTACCTTCTATGCAGG - Intergenic
937673657 2:124565406-124565428 GATTATTATGCATTGTATGCCGG + Intronic
938009005 2:127813329-127813351 GAGAATCCTGCCTTCTATCCTGG - Intergenic
941959020 2:171235514-171235536 GAGGAATTTGGCTTCTGTGCAGG + Intergenic
943173042 2:184429535-184429557 GAGGATTATGCGTTTCATCCAGG - Intergenic
1175732418 20:61362789-61362811 GAGGATCATGCGTTCTGTGTTGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1178953311 21:37003194-37003216 GAGGATAATGCCTGATTTGCAGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1180392350 22:12296429-12296451 GTAGATTTTGCCTTCTATGGGGG + Intergenic
1180407396 22:12568341-12568363 GTAGATTTTGCCTTCTATGGGGG - Intergenic
1182693304 22:32178356-32178378 GAGGAACATGCATTCTAGGCTGG - Intergenic
956900304 3:73708492-73708514 GAGGACTATGCATTCTATGGTGG - Intergenic
957301420 3:78396758-78396780 AAAGATGATGCCTGCTATGCAGG + Intergenic
959397424 3:105858287-105858309 CAGGACTATGACTTCTAAGCAGG + Intronic
959666608 3:108929676-108929698 GAGGATTCAGCCTTCTATCATGG - Intronic
961091723 3:124118407-124118429 TAGGATTATGCCATCTCTGTGGG + Intronic
961168344 3:124779019-124779041 GAGGATAATGCCTCCCTTGCAGG + Intronic
965295215 3:166936703-166936725 TAGGATTATGTCAGCTATGCAGG + Intergenic
977783159 4:101002969-101002991 GAAGATGATGCCTTCCATTCTGG + Intergenic
978133112 4:105223696-105223718 GAGAATAATGCCATCTATGCAGG + Intronic
984054599 4:174911134-174911156 GATGATTATGTTTTCTCTGCAGG - Intronic
986759824 5:10869770-10869792 GATAATTATGCCTCCTGTGCTGG + Intergenic
990114058 5:52367291-52367313 GTGGACTATGCCCTCTAAGCTGG - Intergenic
992766347 5:80004346-80004368 CAGGATTCTGCCTTCTAGGTAGG + Intronic
994727681 5:103455501-103455523 GATTATTATACATTCTATGCAGG - Intergenic
995036704 5:107542593-107542615 GAAGGTCATGCCTTCTCTGCCGG + Intronic
996768659 5:127061907-127061929 GAGGATTAGGCCATCTGTGGTGG + Intronic
1001486968 5:172126852-172126874 GGGTATGATGCCTTCTTTGCGGG - Intronic
1008803620 6:55401073-55401095 AAGGGATATGCCTTCTATGCAGG - Intronic
1015675871 6:135747976-135747998 GATTATTATGCATTCTATGCTGG - Intergenic
1016210404 6:141525793-141525815 GAGATTTATTCCATCTATGCAGG + Intergenic
1017616873 6:156255315-156255337 AAGGATTATGCCTTTGATGAAGG + Intergenic
1019875825 7:3809720-3809742 GAGGATTATGTCTTCGTGGCTGG - Intronic
1027527437 7:79287643-79287665 GAGGATAATACCTGCTTTGCAGG + Intronic
1031551591 7:123120526-123120548 GAGGATTTTCCCTTCCATGTGGG - Intronic
1033392276 7:140939462-140939484 GATGATTTTGCATTCTACGCAGG + Intergenic
1037994713 8:23343722-23343744 CAGGATTATGCCTTCCAGCCTGG + Intronic
1038465005 8:27753801-27753823 GAGGATTATGAAGTCTGTGCTGG - Intronic
1040423086 8:47259265-47259287 GAGGTTTATGCTGTCTATACTGG - Intergenic
1042425492 8:68643307-68643329 GAGAATTATACTTTCTAAGCAGG + Intronic
1042657390 8:71114956-71114978 GACGCTCATGCTTTCTATGCTGG + Intergenic
1045579636 8:103464586-103464608 GAGGATTAAGCTTTCTATTTGGG + Intergenic
1045801099 8:106102233-106102255 GATTATTATGCATTGTATGCCGG + Intergenic
1046169359 8:110485326-110485348 GAGGATTTTGTCTTGTATCCAGG + Intergenic
1048589450 8:135807666-135807688 GATGATTATGACTTCTGTGTGGG + Intergenic
1048641286 8:136365082-136365104 GAAGATTATGTCTTAAATGCAGG + Intergenic
1050568863 9:6916767-6916789 GAGGATTATGTCTTCTAAAATGG + Intronic
1053611069 9:39713576-39713598 GAGGATTATACCTCCTTTTCTGG + Intergenic
1053721736 9:40953167-40953189 GTAGATTTTGCCTTCTATGGGGG - Intergenic
1053869113 9:42471627-42471649 GAGGATTATACCTCCTTTTCTGG + Intergenic
1054087185 9:60757582-60757604 GAGGATTATACCTCCTTTTCTGG - Intergenic
1054242451 9:62628819-62628841 GAGGATTATACCTCCTTTTCTGG - Intergenic
1054344225 9:63898822-63898844 GTAGATTTTGCCTTCTATGGGGG + Intergenic
1054556578 9:66663337-66663359 GAGGATTATACCTCCTTTTCTGG - Intergenic
1055716341 9:79122190-79122212 GAGGATGTTGCCTGCCATGCTGG + Intergenic
1057870264 9:98711324-98711346 GAGGAACATGCATTCTAGGCTGG - Intergenic
1190527842 X:51345954-51345976 GATGATTATGCGTGATATGCAGG - Intergenic
1193604650 X:83550966-83550988 GAGGATCATAACTTCTATGTTGG + Intergenic
1193986860 X:88252992-88253014 GAGGATTATGTCTTGTATCTTGG - Intergenic
1197149211 X:123202106-123202128 GAGGACTATTCATTTTATGCTGG + Intronic
1198679276 X:139164262-139164284 GTGGATAATTCCTTCTATGTCGG + Intronic
1201726405 Y:17156593-17156615 GTGGATTATGCCTGCTATCCTGG - Intergenic