ID: 916425928

View in Genome Browser
Species Human (GRCh38)
Location 1:164679748-164679770
Sequence AAACCTATAGTGCTACTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916425928_916425929 29 Left 916425928 1:164679748-164679770 CCTGTGAGTAGCACTATAGGTTT 0: 1
1: 0
2: 0
3: 2
4: 62
Right 916425929 1:164679800-164679822 TTATAACTACCCTGTGAAATAGG 0: 1
1: 0
2: 5
3: 83
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916425928 Original CRISPR AAACCTATAGTGCTACTCAC AGG (reversed) Intronic
910607112 1:89099199-89099221 CAACCAAAAGTGCTACCCACTGG - Intergenic
910999031 1:93142736-93142758 TAACATGTTGTGCTACTCACGGG + Intergenic
911337339 1:96596499-96596521 AAACGTAGAGTGCAGCTCACTGG + Intergenic
912707385 1:111925010-111925032 AAACTTTTAGTGCTAGTCCCTGG - Intronic
915090842 1:153424348-153424370 ACACCTAAAGTGCTACTCCTAGG + Intergenic
916425928 1:164679748-164679770 AAACCTATAGTGCTACTCACAGG - Intronic
918099855 1:181364003-181364025 AAACCAACAGTGATATTCACGGG + Intergenic
919871601 1:201826121-201826143 AAACATACAGTGCTAGTAACAGG + Exonic
921891475 1:220358341-220358363 AAACCTACAGTGCTCCTCCCGGG + Intergenic
1064704746 10:18060205-18060227 AAACATATTGTGCAACTCTCGGG + Intergenic
1067416071 10:46104156-46104178 ACACCTATAGTCCTAGTTACTGG - Intergenic
1079073868 11:17371272-17371294 AACCCTATAGTGCTACCTAGTGG + Intronic
1082841240 11:57691921-57691943 AAGCTTATAGTGCTGCTTACAGG + Intronic
1089624006 11:119739963-119739985 AAACTTATAGTGCTACTGTGAGG + Intergenic
1099560000 12:84160742-84160764 AGCCCTATAGTTCTACTCAGAGG - Intergenic
1107404639 13:40101149-40101171 AAACCAACAGTTCTAATCACAGG - Intergenic
1107480651 13:40783143-40783165 ACACCTATAGTCCTAGTTACTGG + Intergenic
1112331865 13:98483073-98483095 AATCCCAAAGTGCTACTCCCTGG + Intronic
1114976171 14:28102832-28102854 AGACCTATAATGGTGCTCACAGG - Intergenic
1117733313 14:58745612-58745634 AAACCAATAGCCCTACTCAAAGG - Intergenic
1124406967 15:29401729-29401751 AGCCCTTTATTGCTACTCACTGG - Intronic
1130104596 15:80919890-80919912 AAACCTCCAGTGCTCCTCCCAGG + Intronic
1138084307 16:54119807-54119829 AAACTTATGTTGCTGCTCACAGG - Exonic
1139323163 16:66131668-66131690 AAACCTTGAGTTCTACTCCCAGG - Intergenic
1142209585 16:88802467-88802489 AAACCTATAGCGCTCCTATCTGG - Intergenic
1147930341 17:43976806-43976828 AAACATATAGAGATAGTCACTGG - Intronic
1160241370 18:77125702-77125724 AAATCTATAGCCCTACTCATGGG + Intronic
1167802555 19:51754169-51754191 CAACCTAGTGTGCTAATCACAGG - Intronic
925131803 2:1499082-1499104 GACCCCAAAGTGCTACTCACAGG + Intronic
929086970 2:38177651-38177673 AAACCTATGGTGCTGGTCTCAGG - Intergenic
933598148 2:84303338-84303360 AAGGCTATAGAGGTACTCACAGG + Intergenic
938832499 2:135066630-135066652 AAACCTATGTTAATACTCACTGG - Intronic
944659778 2:201911702-201911724 AAATCTAAAATGGTACTCACTGG - Intergenic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1172536653 20:35678730-35678752 ACACCTGTAGTGCTAGTTACTGG + Intronic
1173132933 20:40411639-40411661 AAACCTTTACTGCTCCTCCCAGG + Intergenic
1173266491 20:41487786-41487808 GAACATAAAGTGCTTCTCACTGG - Exonic
1182909210 22:33966706-33966728 GAACCTATAGTCCTCATCACAGG + Intergenic
966012253 3:175095112-175095134 AAACCTAGAGTGGTACTCTATGG - Intronic
968145596 3:196295821-196295843 AAACCTAGAGTGCTGCTTATAGG - Intronic
977060091 4:92247783-92247805 TAACCTATAGAGCTACACAAGGG - Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
984548272 4:181132215-181132237 AAACCTAAAATCGTACTCACAGG + Intergenic
1001628536 5:173157305-173157327 AAACCAATTGTGCTAATCTCTGG - Intronic
1011818677 6:91224343-91224365 AAACTTACATTGCTATTCACTGG + Intergenic
1013968113 6:115980817-115980839 AAACACATTGTGCTTCTCACTGG - Intronic
1015022966 6:128498964-128498986 ATACCTATTGTGATACTCAATGG - Intronic
1015026248 6:128536156-128536178 AGACCTCTAGTGCTAATTACTGG - Intergenic
1022252020 7:28617869-28617891 ACACCTATACTGCTGCTCAAAGG - Intronic
1030979703 7:116171859-116171881 AAACCTCTACTGCTTTTCACAGG - Intergenic
1031291701 7:119945915-119945937 AAATCTATAGTGTTATTCTCAGG + Intergenic
1037828090 8:22171696-22171718 GAACCTACACTGCTAGTCACTGG - Intronic
1042444368 8:68866993-68867015 GACTCAATAGTGCTACTCACTGG + Intergenic
1043063817 8:75541061-75541083 AAACCTGTAGTGCAACTTTCAGG + Intronic
1043465148 8:80498005-80498027 AAAATTATAGTGCTGCTCCCAGG - Intronic
1050225835 9:3454221-3454243 AAAGGTATATTTCTACTCACAGG + Intronic
1058384749 9:104421420-104421442 AAACATATAGTACTAGTTACAGG - Intergenic
1059516291 9:114898827-114898849 AAACCTATAATGCGACTCCTAGG + Intronic
1192184529 X:68937986-68938008 AAACCAATAGATCTACTCACTGG + Intergenic
1193894806 X:87100116-87100138 CAACCTAGAGAGATACTCACTGG + Intergenic
1193913948 X:87342350-87342372 AAACCTAAAGTGGTCCTCCCTGG - Intergenic
1195265070 X:103172034-103172056 AAAAATATAGTTTTACTCACAGG - Intergenic
1198985964 X:142454200-142454222 AAACATATACTGCTTCTCAATGG + Intergenic